ID: 1078044260

View in Genome Browser
Species Human (GRCh38)
Location 11:7899014-7899036
Sequence ATAGTCACATTCTGAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078044257_1078044260 22 Left 1078044257 11:7898969-7898991 CCTTATTTTATCTTAATTACCAC No data
Right 1078044260 11:7899014-7899036 ATAGTCACATTCTGAAAGTCAGG No data
1078044259_1078044260 3 Left 1078044259 11:7898988-7899010 CCACTTTAAAGGTGCTAGCTCTA No data
Right 1078044260 11:7899014-7899036 ATAGTCACATTCTGAAAGTCAGG No data
1078044256_1078044260 30 Left 1078044256 11:7898961-7898983 CCTAGTGACCTTATTTTATCTTA No data
Right 1078044260 11:7899014-7899036 ATAGTCACATTCTGAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078044260 Original CRISPR ATAGTCACATTCTGAAAGTC AGG Intergenic
No off target data available for this crispr