ID: 1078044263

View in Genome Browser
Species Human (GRCh38)
Location 11:7899038-7899060
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078044259_1078044263 27 Left 1078044259 11:7898988-7899010 CCACTTTAAAGGTGCTAGCTCTA No data
Right 1078044263 11:7899038-7899060 CTTCAACATATGAATGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078044263 Original CRISPR CTTCAACATATGAATGTCAG GGG Intergenic
No off target data available for this crispr