ID: 1078048552

View in Genome Browser
Species Human (GRCh38)
Location 11:7940775-7940797
Sequence GAGAAAAAGCATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078048544_1078048552 21 Left 1078048544 11:7940731-7940753 CCATAATCACAAGATGACAAGGG No data
Right 1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG No data
1078048549_1078048552 -10 Left 1078048549 11:7940762-7940784 CCATTAAGCAGAGGAGAAAAAGC No data
Right 1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078048552 Original CRISPR GAGAAAAAGCATAAGGAGGA AGG Intergenic
No off target data available for this crispr