ID: 1078050740

View in Genome Browser
Species Human (GRCh38)
Location 11:7963027-7963049
Sequence GGTTCCAACAACTGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078050740_1078050750 7 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050750 11:7963057-7963079 GGAGACCACCAAGGACTCTGGGG 0: 1
1: 0
2: 0
3: 26
4: 234
1078050740_1078050756 29 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050756 11:7963079-7963101 GCACCAGGGACTAGAGGACAAGG 0: 1
1: 0
2: 1
3: 22
4: 227
1078050740_1078050755 23 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050755 11:7963073-7963095 TCTGGGGCACCAGGGACTAGAGG 0: 1
1: 0
2: 2
3: 25
4: 386
1078050740_1078050749 6 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050749 11:7963056-7963078 TGGAGACCACCAAGGACTCTGGG 0: 1
1: 0
2: 0
3: 22
4: 146
1078050740_1078050754 15 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050754 11:7963065-7963087 CCAAGGACTCTGGGGCACCAGGG 0: 1
1: 0
2: 2
3: 40
4: 769
1078050740_1078050748 5 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050748 11:7963055-7963077 GTGGAGACCACCAAGGACTCTGG 0: 1
1: 0
2: 1
3: 17
4: 187
1078050740_1078050752 14 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050752 11:7963064-7963086 ACCAAGGACTCTGGGGCACCAGG 0: 1
1: 0
2: 0
3: 19
4: 212
1078050740_1078050746 -2 Left 1078050740 11:7963027-7963049 CCCTCCTGACAGTTGTTGGAACC 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1078050746 11:7963048-7963070 CCCTCAGGTGGAGACCACCAAGG 0: 1
1: 0
2: 0
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078050740 Original CRISPR GGTTCCAACAACTGTCAGGA GGG (reversed) Intronic
905844883 1:41220850-41220872 GGTTCCAACCTGTGTCAAGATGG - Intronic
906632279 1:47381746-47381768 GGCTCCAAGAACTTCCAGGAGGG + Intergenic
907705856 1:56831803-56831825 GGTTCTATCAAATGTCAGGGGGG - Intergenic
913524472 1:119677898-119677920 CTTTCCCACAACTGTCAGCAAGG - Intronic
914320252 1:146552178-146552200 GGTTCTAGCCACTGTCAGGCTGG + Intergenic
919947611 1:202331991-202332013 GGTTCACACAAATGCCAGGATGG + Intronic
920972689 1:210756194-210756216 GGTTCCAAAGACTGTAAGCAGGG - Intronic
1063069653 10:2648433-2648455 GAGTCCAACAACAGGCAGGAGGG - Intergenic
1063987019 10:11515443-11515465 GGTTCCCACAACCTCCAGGAGGG - Intronic
1064541797 10:16413126-16413148 AGTAACAACAACTGTCAGGAAGG - Intergenic
1066506513 10:36050264-36050286 GGATCCAACAATTCTCAGGAGGG - Intergenic
1068661320 10:59626235-59626257 GGTGTCACCAACTGTGAGGAAGG + Intergenic
1075902223 10:126052128-126052150 GGGTCCAGCACCTGTGAGGATGG - Intronic
1077429256 11:2507918-2507940 AGTTCCAAAACCTCTCAGGAGGG - Intronic
1078050740 11:7963027-7963049 GGTTCCAACAACTGTCAGGAGGG - Intronic
1078130555 11:8610771-8610793 GGTTCACAGAATTGTCAGGAAGG + Intergenic
1078492289 11:11780786-11780808 GGGTGCAGCAACTCTCAGGAAGG + Intergenic
1078722735 11:13898958-13898980 GGTTCCACCATCTGACTGGAGGG - Intergenic
1096774410 12:53955410-53955432 GATTCCAGCGACTGGCAGGAGGG - Exonic
1099674057 12:85733802-85733824 GCTGCAAACAACTGTGAGGAAGG + Intergenic
1101931553 12:109018354-109018376 GGTTCCTTCAAGTGTGAGGAAGG + Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1113668526 13:112159093-112159115 GGTGCCAACAACTGGGAGGTGGG + Intergenic
1113922933 13:113924323-113924345 GGTTCCAAAAACTCCCAGGGTGG + Intergenic
1114466014 14:22923325-22923347 GCTTCCAACTACTGTCATGGAGG + Intronic
1117290270 14:54325500-54325522 GCTTCCAACAAGGGTAAGGAGGG + Intergenic
1120732384 14:88018261-88018283 CTTTCCAACAACTGGAAGGAAGG + Intergenic
1121288306 14:92753776-92753798 GGTTCTAACAACTCGGAGGAGGG - Intergenic
1121520775 14:94584833-94584855 GGTTCCAACCCTTGGCAGGAGGG + Intronic
1122057560 14:99114460-99114482 AGTTCCAACATATGTCAAGAAGG - Intergenic
1122573898 14:102728609-102728631 GCTTCCAAGCACTGCCAGGAGGG - Exonic
1126336224 15:47588908-47588930 GGTTGCCACAACTGTCACAATGG + Intronic
1128900304 15:71414889-71414911 GGTTCCAACAACTTCAATGAGGG - Intronic
1129035706 15:72647302-72647324 GCTTCCAACCAGTGTCAGGTGGG - Intergenic
1129214178 15:74089914-74089936 GCTTCCAACCAGTGTCAGGTGGG + Intergenic
1129399831 15:75275455-75275477 GCTTCCAACCAGTGTCAGGTGGG - Intronic
1134433721 16:14235765-14235787 TGTCCCAGCCACTGTCAGGAAGG - Intronic
1140013281 16:71157928-71157950 GGTTCTAGCCACTGTCAGGCTGG - Intronic
1148790639 17:50170701-50170723 GGGTCCAACAACTGTCTAGGTGG - Intronic
1150379507 17:64709574-64709596 AGTTCCAACAAGGGTCAGGTTGG + Intergenic
1156399166 18:36725169-36725191 AGTTCCAAGAACTCTCAGGGAGG - Intronic
1157742548 18:50106379-50106401 GGTCCCAAGAACAGTGAGGAGGG - Intronic
1158823245 18:61185354-61185376 GGTGTGAACAACTGACAGGAAGG - Intergenic
1160016318 18:75143455-75143477 GGATCCAACAAGTGTCTGAAGGG + Intergenic
1161262169 19:3344100-3344122 GGTTCCAGGAACTGCCAGCAGGG + Intergenic
1161854957 19:6758999-6759021 GGTTCGAACAACTGCAAGGAGGG + Intronic
925141456 2:1552559-1552581 GGTTCCAACAGCTTTCAGTTTGG + Intergenic
931850001 2:66243512-66243534 GGTTCAAAGAACTGATAGGAAGG - Intergenic
931850944 2:66249880-66249902 GGTTCAAATAACTGATAGGAAGG - Intergenic
932423708 2:71615877-71615899 GGCTGCATCAACTGTGAGGATGG - Intronic
933247712 2:79994507-79994529 GGATCCAATGACTGTCTGGAAGG - Intronic
936170460 2:110167463-110167485 GGTTCCAGGAACTTCCAGGATGG + Intronic
936174310 2:110205545-110205567 GTTTACATCAACTCTCAGGAAGG + Intergenic
938383891 2:130851282-130851304 GGTGGCGCCAACTGTCAGGAGGG + Intronic
942357890 2:175139030-175139052 GCTTACAACAACTGTGAGGTAGG - Intronic
1170272769 20:14547055-14547077 GTTTCCAACAAATTTCTGGATGG - Intronic
1174081576 20:47973880-47973902 GGCTCCCCCAACAGTCAGGAGGG + Intergenic
1177775491 21:25562018-25562040 GGTTCCAAGAACAGGCAGGAGGG + Intergenic
1177911287 21:27035887-27035909 GGTTCCACCAACTACGAGGAAGG + Intergenic
1183538676 22:38417418-38417440 GGTTCCAAAACCAGTCAGGGAGG - Intergenic
1183952878 22:41361689-41361711 GGTTCCAAGGACCCTCAGGAAGG + Intergenic
949356740 3:3188950-3188972 GGTTCCCACAACTTTCTGGAAGG + Intergenic
950222669 3:11207880-11207902 TGCCCCAACATCTGTCAGGAAGG + Intronic
952930474 3:38356453-38356475 GGTTGCCACTACTGGCAGGAGGG - Intronic
953843307 3:46407027-46407049 GGTACCAGCTACTGTCAGCAGGG - Intergenic
958169321 3:89918177-89918199 GGTCCCAACAAATGACAGGATGG - Intergenic
960973086 3:123153017-123153039 GCTTCCAAGAGGTGTCAGGAGGG - Intronic
964425020 3:156543361-156543383 GATTACACCAAGTGTCAGGAAGG - Intronic
964551299 3:157887736-157887758 GCTTCCATCCCCTGTCAGGATGG - Intergenic
965456683 3:168910161-168910183 GGTTCTAACACCTGTGAGGTGGG - Intergenic
966257097 3:177929545-177929567 GGTTCCAAAATCTGTCAGTCAGG - Intergenic
970356537 4:15259339-15259361 GGTTCCAACAACAGTCAGAAGGG - Intergenic
971929858 4:33067016-33067038 GGTTTGAAAAAATGTCAGGACGG - Intergenic
976482959 4:85565965-85565987 GGTTTCAACAACTGTTTGTATGG - Intronic
977213599 4:94251130-94251152 CTTTTTAACAACTGTCAGGATGG + Intronic
979303660 4:119116749-119116771 GATTCCAACAATTGTCAGAATGG - Intergenic
994190231 5:96861096-96861118 AGTTCAAAGAATTGTCAGGAAGG - Intronic
999123821 5:149231285-149231307 TGTTCTGACAAATGTCAGGAAGG + Intronic
1000422132 5:161049933-161049955 AGTTCCAATAACTGTAAGGATGG + Intergenic
1001814001 5:174652222-174652244 GGCTACCACAACTGTCAAGAGGG - Intergenic
1002909090 6:1474914-1474936 GGTTCCAAACACTGGCAAGAAGG + Intergenic
1005252391 6:23962381-23962403 AGTCCTAACAACTGTGAGGAAGG - Intergenic
1011139685 6:84139517-84139539 ATTGCCAAAAACTGTCAGGAAGG - Intronic
1011560945 6:88614755-88614777 GGTTTCATCAACTTTCAGAAAGG + Intronic
1011751656 6:90460563-90460585 GGTTCAATCAACTGTCACTAGGG - Intergenic
1012092952 6:94922297-94922319 AGTTCCAACAACCTTCAGGAAGG + Intergenic
1014831450 6:126107239-126107261 ATAACCAACAACTGTCAGGAAGG - Intergenic
1016088727 6:139948121-139948143 GGTTCCCACAAATGTCAAAAAGG - Intergenic
1016644517 6:146390642-146390664 GGTTACAACAACTGTCGGAATGG - Intronic
1018242753 6:161794510-161794532 GGGGCCAAGAACTGTCAGGATGG - Intronic
1024792121 7:52978360-52978382 AGTTCCAACATCTGCCAGGGAGG - Intergenic
1030043361 7:105472362-105472384 AGTCCCAGCTACTGTCAGGATGG - Intronic
1032747250 7:134798346-134798368 GGTTCCAACATCTGGCACCAGGG - Intronic
1036531675 8:9595450-9595472 TGTTCCAACTGCTTTCAGGAAGG + Intronic
1038331715 8:26614285-26614307 GGTTCCAGGCACTGGCAGGATGG + Intronic
1040974015 8:53170021-53170043 GGACCAAACAACTGTGAGGAAGG - Intergenic
1044466770 8:92515872-92515894 GGTGCCAACAGCTCTCTGGATGG + Intergenic
1048525710 8:135200508-135200530 GGATTCAAGAACTGTCAAGAAGG - Intergenic
1057904763 9:98975047-98975069 GCTTCCACCAACTGCAAGGAAGG - Intronic
1058972050 9:110092865-110092887 AGTTCCAACAAGTCTCAGAATGG + Intronic
1062047000 9:134428983-134429005 GGTTCCAGAGCCTGTCAGGATGG + Intronic
1187402684 X:18975609-18975631 GGCTTAAACAACTGTTAGGATGG - Intronic
1190868466 X:54404890-54404912 AGTTCAAACAACTGAAAGGATGG - Intergenic
1199950168 X:152700299-152700321 GATTCCCAGAACTGTCAGGAGGG - Intronic
1199955078 X:152735764-152735786 GATTCCCAAAATTGTCAGGAGGG - Intronic
1199959508 X:152768162-152768184 GATTCCCAGAACTGTCAGGAGGG + Intronic
1200711351 Y:6487466-6487488 TGCTCCAACAACAGGCAGGAGGG + Intergenic