ID: 1078053470

View in Genome Browser
Species Human (GRCh38)
Location 11:7987388-7987410
Sequence GGCCACGCCAACCCCAGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078053461_1078053470 29 Left 1078053461 11:7987336-7987358 CCTTCTTTCTCGACAAGATGGCC 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG 0: 1
1: 1
2: 0
3: 17
4: 174
1078053467_1078053470 -6 Left 1078053467 11:7987371-7987393 CCAGTAAGTGCTCCTCCGGCCAC 0: 1
1: 1
2: 1
3: 4
4: 81
Right 1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG 0: 1
1: 1
2: 0
3: 17
4: 174
1078053464_1078053470 8 Left 1078053464 11:7987357-7987379 CCACACCGGCGGTACCAGTAAGT 0: 1
1: 2
2: 0
3: 0
4: 16
Right 1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG 0: 1
1: 1
2: 0
3: 17
4: 174
1078053465_1078053470 3 Left 1078053465 11:7987362-7987384 CCGGCGGTACCAGTAAGTGCTCC 0: 1
1: 2
2: 0
3: 0
4: 36
Right 1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG 0: 1
1: 1
2: 0
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078053470 Original CRISPR GGCCACGCCAACCCCAGTCC CGG Exonic
900117171 1:1033753-1033775 AGCCACCCCAGCCCCAGTCCCGG + Intronic
900138274 1:1127970-1127992 GGCCACCAAAGCCCCAGTCCTGG - Intergenic
900394185 1:2446397-2446419 GGCCACCCCACCCCCAGCCCCGG - Intronic
900486234 1:2924111-2924133 GGCACGGCCAACCCCAGCCCTGG - Intergenic
901405338 1:9041330-9041352 GGCCAGGCCACCCTCACTCCTGG + Intronic
901689179 1:10961318-10961340 GGCCACGCCAAAGCCAGTGTTGG - Intronic
902520170 1:17011510-17011532 GGCGGCGCCATCCCCAGCCCCGG + Intronic
903330777 1:22596055-22596077 GGCCAGGCCACCCCTAGCCCGGG - Intronic
903879606 1:26500203-26500225 GGCAACCTCAACCCCACTCCTGG + Intergenic
911151794 1:94603450-94603472 GGCCACCTCTGCCCCAGTCCAGG - Intergenic
915519711 1:156435001-156435023 AGCCTCGGCAACCTCAGTCCAGG + Intergenic
916883910 1:169048439-169048461 GGCTACGCCAACCCCTGGCAAGG - Intergenic
918989835 1:191684541-191684563 TGTCACCCCACCCCCAGTCCAGG - Intergenic
1062996448 10:1871062-1871084 GTCCTGGCCAACCCCTGTCCTGG + Intergenic
1063575291 10:7256742-7256764 GTCCACACCAACCCCAGCCTGGG + Intronic
1067239308 10:44476733-44476755 GGGGACACCAACCCCAGTCCAGG - Intergenic
1072654069 10:97318682-97318704 AGCAATGCCAACCCCAGTCCAGG + Intergenic
1074328937 10:112483655-112483677 TGCCACCCCAACCCCAGTCATGG + Intronic
1074760432 10:116663505-116663527 CACCACGCCCACCCCAGCCCTGG - Intergenic
1075016946 10:118916851-118916873 AGCCACGGCATGCCCAGTCCAGG + Intergenic
1075562013 10:123474841-123474863 GGCCATGCCAACAGCAGCCCAGG - Intergenic
1076691266 10:132224875-132224897 GGCCACGGCGAGGCCAGTCCTGG - Intronic
1077076728 11:705609-705631 AGCCATGCCCACCCCAGGCCTGG - Intronic
1077162608 11:1120641-1120663 TGCCACTCCCACCCCTGTCCCGG + Intergenic
1077316040 11:1919787-1919809 GGCCCCGTCGGCCCCAGTCCTGG - Intronic
1077495565 11:2885033-2885055 GTCCACCCCGCCCCCAGTCCCGG - Exonic
1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG + Exonic
1078091225 11:8265911-8265933 GGCCACAGCTAGCCCAGTCCTGG - Intronic
1081732857 11:45383867-45383889 GCCCCCTCCAACCCCACTCCTGG + Intergenic
1083423729 11:62571717-62571739 GGGAATGCCAACACCAGTCCAGG + Intronic
1084705896 11:70815811-70815833 TGCCACGCCCACTGCAGTCCTGG + Intronic
1090635915 11:128690443-128690465 GCCCACCCCAAACCCAGTCTGGG + Intronic
1092001093 12:5032994-5033016 AGCCACGCCAGCCCCAGCCCCGG + Intergenic
1097194649 12:57236758-57236780 GCCCACCCCAACCCCACCCCGGG + Intronic
1104680173 12:130745059-130745081 GGCCACCCCAACCCCTGTCTCGG + Intergenic
1104831378 12:131754308-131754330 GGGCTCGCCAAGCTCAGTCCTGG - Intronic
1105847757 13:24308108-24308130 GGCCACGCGCTCCCCATTCCGGG - Intronic
1106286015 13:28318437-28318459 GGCCTTGCCACCCCCAGCCCTGG - Intronic
1107004565 13:35593815-35593837 GGCTACGCAAACCCCAAGCCAGG - Intronic
1107646203 13:42496612-42496634 GGCCACGCCAATGGTAGTCCTGG + Intergenic
1108648743 13:52455363-52455385 GGCCCCGGCAACTGCAGTCCAGG + Intergenic
1116436269 14:44897772-44897794 GGCCACGCCCACCCTGGCCCTGG - Intronic
1118911464 14:70065390-70065412 TGCCACACCCACCCCAGTCATGG + Intronic
1121468228 14:94129490-94129512 GGCTTCCCCAACCCCAGCCCAGG - Intronic
1122481375 14:102049624-102049646 AGCCACTCCCACCCCAGCCCAGG - Intronic
1122881824 14:104693714-104693736 GGCCACGTCCACCCCCGACCCGG - Intronic
1123144936 14:106120322-106120344 GCCCACGCCAACTCTGGTCCTGG + Intergenic
1123467513 15:20527880-20527902 GGCCCCACCAACCTCTGTCCAGG - Intergenic
1123650601 15:22473162-22473184 GGCCCCACCAACCTCTGTCCAGG + Intergenic
1123741009 15:23282004-23282026 GGCCCCACCAACCTCTGTCCAGG + Intergenic
1123745989 15:23320554-23320576 GGCCCCACCAACCTCTGTCCAGG - Intergenic
1124278260 15:28343871-28343893 GGCCCCACCAACCTCTGTCCAGG - Intergenic
1124304442 15:28567737-28567759 GGCCCCACCAACCTCTGTCCAGG + Intergenic
1127982665 15:64046210-64046232 CGCCCCGCCAGCCCCAGACCCGG + Intronic
1128089788 15:64911773-64911795 TGCCCCGGCCACCCCAGTCCCGG - Intronic
1130459594 15:84151383-84151405 GGCCACTCCCCCGCCAGTCCTGG + Intergenic
1132802920 16:1763035-1763057 GGCCTCCCCAACCCCATTGCAGG - Intronic
1132999661 16:2842479-2842501 GGTCAGGCCAACTTCAGTCCGGG - Intergenic
1133067310 16:3217874-3217896 GGCCAGGCCAACTCCTGTCAGGG + Intergenic
1133090660 16:3401391-3401413 GGCCCAGCCAGCCCCAGGCCTGG - Intronic
1133203156 16:4217042-4217064 GCCCACCCCATCCCCAATCCAGG + Intronic
1133247931 16:4461641-4461663 TACCACCCCAACCCAAGTCCTGG + Intergenic
1134127767 16:11628230-11628252 GGCCACACCAACCTCAGGGCTGG - Intronic
1134291556 16:12905792-12905814 AGCCTGGCCAACCCCAGGCCAGG - Intronic
1136346086 16:29677087-29677109 CGTCACGCCAGCCCCAGTCCCGG + Intronic
1136694263 16:32062642-32062664 ACCCACACCAACCCCAGGCCTGG - Intergenic
1136794760 16:33005906-33005928 ACCCACACCAACCCCAGGCCTGG - Intergenic
1136875145 16:33848486-33848508 ACCCACACCAACCCCAGGCCTGG + Intergenic
1137926524 16:52546750-52546772 GCCCCGGCGAACCCCAGTCCCGG - Exonic
1139659361 16:68410312-68410334 GGCCATGCCATCCACAGACCAGG + Intronic
1141908238 16:87041596-87041618 AGCCTCTCCAACCCCAGCCCTGG + Intergenic
1142257890 16:89024065-89024087 GGCCATGTCATCCCCAGACCAGG - Intergenic
1142350224 16:89576226-89576248 GGACACCCCACCCCCAGACCTGG - Intronic
1203097023 16_KI270728v1_random:1267556-1267578 ACCCACACCAACCCCAGGCCTGG - Intergenic
1143478061 17:7214287-7214309 GGCCACGCCACGCCCATCCCAGG + Intronic
1147617160 17:41836276-41836298 GGCCCCACCAACCCCCGCCCGGG - Intronic
1147914280 17:43877389-43877411 GGCCACACCCACCCCATTCCTGG - Intronic
1149693566 17:58598691-58598713 GGCAACGTCAAACCCAGCCCTGG + Intronic
1151337111 17:73446525-73446547 GGCCTTGCCATCCCCATTCCAGG - Intronic
1152747767 17:82049164-82049186 GGCCACGCCTGCCCCTGGCCAGG + Intronic
1156350572 18:36298089-36298111 GGCCGCGCCCAGCCCAGCCCAGG - Intronic
1157279708 18:46338334-46338356 GGCCACTCCCACCCCTATCCAGG + Intronic
1157621275 18:49018631-49018653 GGCCAGGGCACCCCCAGGCCAGG - Intergenic
1159102358 18:63970644-63970666 GGCCCCGCCACCCGCACTCCCGG - Intronic
1160577441 18:79864424-79864446 GCCCCGGCCCACCCCAGTCCCGG - Intronic
1160784368 19:892733-892755 GGCGACCCCAAACCCACTCCAGG + Intronic
1161265021 19:3359974-3359996 GGCCCCCGCAACCCCAGGCCGGG + Intronic
1161468965 19:4446972-4446994 GGCCACACCCCACCCAGTCCAGG + Intronic
1161474339 19:4475764-4475786 GGCCACCCCCACCCCATTCATGG + Intronic
1161968399 19:7561597-7561619 GGCCACCCCCAGCCCAGTCCAGG - Exonic
1163630354 19:18415264-18415286 GGGGGCGCCAGCCCCAGTCCTGG + Intergenic
1163718600 19:18886862-18886884 TGCCACCCCCACCCCAGTCCAGG + Intronic
1163786602 19:19277909-19277931 GGCCACCACAGCCCCAGCCCTGG - Intronic
1165059019 19:33195777-33195799 GCCCACCCCAACCTCAGTGCGGG + Intronic
1165066752 19:33234136-33234158 GGCCAGGCCAACCTTAGACCTGG - Intergenic
1166344702 19:42157905-42157927 GGCCACCACAACCCCAGGGCTGG + Intronic
1167026756 19:46925386-46925408 GGCCAAGCCAACCCCTGTGTGGG + Intronic
1167232450 19:48293613-48293635 GGCGAGCCCAGCCCCAGTCCAGG + Intergenic
1168288904 19:55347574-55347596 GTCCAAACCAACCCCATTCCAGG - Exonic
1168655670 19:58125807-58125829 GGCCTGGCTGACCCCAGTCCTGG + Intergenic
930027714 2:47039491-47039513 GGCTAAGCCAAGCACAGTCCTGG - Intronic
931036624 2:58251475-58251497 GGCCACGCCAGCCCCAGTCCCGG + Intergenic
935327979 2:101955135-101955157 GGTCACGCCAACCAGAGTCTGGG + Intergenic
937872495 2:126796197-126796219 GGCCAGGCCAAGTCCTGTCCAGG - Intergenic
937912539 2:127082451-127082473 GCCCACGCCAACCCTGGTCTCGG - Intronic
938365068 2:130727762-130727784 GGCCACGCCCACCACAGCCCCGG - Intergenic
938817404 2:134918524-134918546 CGCCCCGCCAACCCTAGACCCGG + Intronic
944431088 2:199634243-199634265 GCCCCCGCCAACCCCGGCCCAGG - Intergenic
948676615 2:239600773-239600795 GACCACGTCAGCCCCTGTCCTGG + Intergenic
949048657 2:241885154-241885176 TCCCAGGCCAACCCCAGCCCTGG + Intergenic
1168908383 20:1425267-1425289 GGCCACACCACCCCCTGGCCAGG + Intergenic
1168931949 20:1631001-1631023 GGCCACCTCCACCCCAGTGCAGG + Intronic
1169206386 20:3742509-3742531 GGCCCTGCCACCCCCAGTCTGGG + Intronic
1171396816 20:24839891-24839913 GGCCTCATCAACACCAGTCCAGG - Intergenic
1171936378 20:31278559-31278581 CTCCAGGCCAACCCCAGTGCTGG - Intergenic
1175223774 20:57433135-57433157 GGCCCCGCCACACCCAGCCCTGG - Intergenic
1175991634 20:62792826-62792848 TGCCACGCCATTCCCAGCCCTGG + Intergenic
1176045254 20:63089364-63089386 AGTCACGCCACCCCCAGGCCTGG + Intergenic
1176098004 20:63353088-63353110 CTCCACCCCGACCCCAGTCCAGG + Intronic
1176369184 21:6052314-6052336 GGCCACGCCACACCCAGGCTGGG - Intergenic
1178904281 21:36623703-36623725 GACTACCCCAACCCCAGCCCAGG - Intergenic
1179615609 21:42581165-42581187 GGACCCGCCAATCCCAGTGCCGG - Exonic
1179754335 21:43486227-43486249 GGCCACGCCACACCCAGGCTGGG + Intergenic
1179886859 21:44317945-44317967 GGCCACGGCAACCGCAGGCCTGG + Intronic
1180018147 21:45100935-45100957 GCCCACCCCTACCCCAATCCCGG - Intronic
1180157478 21:45984522-45984544 CCCCAGGCCAACCCCAGCCCAGG - Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1180946723 22:19698471-19698493 TCCCACCCCCACCCCAGTCCAGG - Intergenic
1180953894 22:19732809-19732831 GGCCTCAGCAACCCCTGTCCAGG + Intergenic
1181032550 22:20155332-20155354 CCCCACGCCCACCCCAATCCAGG - Intergenic
1181510875 22:23388281-23388303 CCCCACGCCCACCCCAATCCAGG + Intergenic
1181603272 22:23964934-23964956 GACCTCCCCAGCCCCAGTCCAGG + Intergenic
1181605242 22:23976373-23976395 GACCTCCCCAGCCCCAGTCCAGG - Intronic
1182351635 22:29703109-29703131 GGCCATGCCAATCCCCGCCCTGG - Intergenic
1184376993 22:44119856-44119878 GGCCGCCCCACCCCCAGGCCAGG - Intronic
1184510427 22:44930158-44930180 GGCCACACCCGCCCCAGTGCTGG - Intronic
1184601978 22:45549089-45549111 GGCCACGCCATCCCCTGGCCTGG - Intronic
1184767105 22:46577580-46577602 GGCGACCCCCACCCCAGTCCGGG - Intronic
1184900541 22:47444051-47444073 GGCCACCCCACACCCAGCCCTGG + Intergenic
1185271207 22:49929922-49929944 GGCCCTGCAGACCCCAGTCCTGG - Intergenic
954533198 3:51338471-51338493 GGCCAAGCCAATCACAGTGCAGG - Intronic
954834702 3:53455640-53455662 GGCCACTCCAACTCCAGCTCTGG + Intergenic
966080037 3:175989470-175989492 GGCCACGCCCTTCCCAGACCAGG + Intergenic
968588570 4:1446314-1446336 GGCCACCCCAGCTCCAGCCCTGG - Intergenic
968946902 4:3669602-3669624 GGCCACGCCACCAGCAGTCGGGG + Intergenic
969701159 4:8768600-8768622 AGCCACCCCAACTCCATTCCTGG + Intergenic
970000122 4:11356505-11356527 GGGCACTCCATTCCCAGTCCAGG - Intergenic
981708308 4:147684121-147684143 GAACTCGCCAACCCCAGCCCAGG + Exonic
985543900 5:499822-499844 GGCCCAGCCACTCCCAGTCCAGG + Intronic
999722060 5:154405609-154405631 GGACACTCCAACTCCAGACCAGG + Intronic
1002939174 6:1700835-1700857 GGCCATCCCAGCCCCAGTTCTGG + Intronic
1005113721 6:22313854-22313876 GGCCACTCCAACTCCAGCCATGG - Intergenic
1006055795 6:31383823-31383845 GGCAAGGCCGACTCCAGTCCTGG + Intergenic
1008748034 6:54697147-54697169 GGCCACCCCTTCCACAGTCCAGG - Intergenic
1014525367 6:122495523-122495545 GGCTAGCCCAACCCTAGTCCTGG + Intronic
1018383900 6:163285361-163285383 CACCCCGCCAGCCCCAGTCCAGG + Intronic
1018853861 6:167661965-167661987 GCTCACACCAACCCCACTCCAGG + Intergenic
1019421439 7:953072-953094 GGCCACAGCAACCCCAGGCCAGG + Intronic
1019562149 7:1664591-1664613 CGCCACCCCCACCCCTGTCCCGG + Intergenic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1023347815 7:39289241-39289263 GGCCACTCCAGCCCCAGCACTGG + Intronic
1028848605 7:95511397-95511419 GGCCACACCAACCAAAGACCTGG + Intronic
1029132123 7:98339574-98339596 GGCCACGCCAGCCGCATTCCCGG - Intronic
1032062790 7:128739081-128739103 GCCCACGCCACCCGCAGTACGGG + Intergenic
1035579064 8:728507-728529 GTCCACTGCAACCCCACTCCAGG + Intronic
1037987432 8:23298809-23298831 GGCCAGGCCGCCCCCACTCCAGG - Intronic
1040388795 8:46932633-46932655 GGCCAGGCCAGGCCCAGCCCAGG - Intergenic
1041013817 8:53571115-53571137 GGCCACTCCAACACCAGCCATGG + Intergenic
1041170954 8:55141537-55141559 GGCCAGGGGAACCCCAGTGCAGG + Intronic
1041857278 8:62472143-62472165 GGACAAGCCAGCCTCAGTCCTGG + Intronic
1044890039 8:96825091-96825113 GGCCATTCCACCCCCAGACCTGG - Intronic
1045511231 8:102813386-102813408 TGCCAGCCCAAACCCAGTCCAGG - Intergenic
1047256072 8:123214490-123214512 GGGCACGCCGACCACACTCCAGG + Intergenic
1049006250 8:139857487-139857509 GGCAACGTGGACCCCAGTCCAGG + Intronic
1049605607 8:143527939-143527961 GGCCACGCCCACACCACGCCTGG + Intronic
1049616666 8:143578524-143578546 GGACCCCCCAACCCCACTCCAGG + Exonic
1050290461 9:4148817-4148839 GGCCACGTTACCCCCACTCCAGG - Intronic
1054722111 9:68614642-68614664 GGCCACCTCCAGCCCAGTCCTGG + Intergenic
1057053584 9:91944805-91944827 CCCCACCCCCACCCCAGTCCTGG - Intronic
1057382011 9:94576888-94576910 TGCCCCCCCAACCCCAGCCCTGG - Intronic
1059407674 9:114111949-114111971 CGCCACGCCCAGCCCACTCCAGG + Intergenic
1060630320 9:125152031-125152053 GGCAACCCCAAACCTAGTCCCGG + Intronic
1061766912 9:132887318-132887340 GGACATGCCAACCCGGGTCCTGG - Intronic
1062115144 9:134804721-134804743 GCCCAATCCAACCCAAGTCCAGG + Intronic
1062341616 9:136095917-136095939 GGCAGCGCCAGGCCCAGTCCAGG - Intergenic
1062536515 9:137023501-137023523 GGCCGCTCCAGCCCCAGCCCAGG + Intronic
1062612196 9:137380339-137380361 CCCCACCCCAACCCCCGTCCGGG + Intronic
1192252617 X:69425366-69425388 GTCCAGGCCTGCCCCAGTCCTGG - Intergenic
1195693677 X:107650471-107650493 GGCAACCCCAAACCTAGTCCTGG + Exonic
1196683814 X:118494904-118494926 GCCCACCCCCACCCCACTCCTGG + Intergenic
1196683832 X:118494975-118494997 GCCCACCCCCACCCCACTCCTGG + Intergenic
1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG + Intronic
1201282853 Y:12356334-12356356 GGCCACAGCAAGCCTAGTCCAGG - Intergenic