ID: 1078053944

View in Genome Browser
Species Human (GRCh38)
Location 11:7991864-7991886
Sequence AAAACTGCAGAGGGACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078053944_1078053948 8 Left 1078053944 11:7991864-7991886 CCAAGCTGTCCCTCTGCAGTTTT 0: 1
1: 0
2: 2
3: 26
4: 332
Right 1078053948 11:7991895-7991917 CATTTGCTCGGCTCCCCTCACGG 0: 1
1: 0
2: 0
3: 8
4: 80
1078053944_1078053947 -4 Left 1078053944 11:7991864-7991886 CCAAGCTGTCCCTCTGCAGTTTT 0: 1
1: 0
2: 2
3: 26
4: 332
Right 1078053947 11:7991883-7991905 TTTTTAGCTGTTCATTTGCTCGG 0: 1
1: 1
2: 78
3: 1687
4: 6940

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078053944 Original CRISPR AAAACTGCAGAGGGACAGCT TGG (reversed) Intronic
900005147 1:40392-40414 AGAACAGCAGAGGGCCAGCGTGG - Intergenic
901156337 1:7142122-7142144 AAGACTGCAGAGGAACATCTGGG - Intronic
902196949 1:14804859-14804881 AACTCCCCAGAGGGACAGCTAGG + Intronic
902613836 1:17612934-17612956 TAAAGTGCGGACGGACAGCTCGG - Intronic
905463588 1:38136807-38136829 AAGTCTTCAGAGGGAAAGCTGGG + Intergenic
905777549 1:40678772-40678794 ACAACTGTAGATGCACAGCTGGG + Intergenic
906745590 1:48220133-48220155 AAAGCTACACAGGGACAGCAAGG - Intergenic
910048293 1:82944405-82944427 AAAACTGTATAGGCACAGCTTGG + Intergenic
910513595 1:88035278-88035300 AAATATGCAGATGGACACCTTGG + Intergenic
915076890 1:153315370-153315392 AAAACTCCAGAGGAAAACCTAGG - Intergenic
920964459 1:210690574-210690596 CAAACTGCAGATGGGCAGATAGG + Intronic
921919322 1:220648562-220648584 ACAAATTCAGAGGCACAGCTTGG + Intronic
922528714 1:226326559-226326581 AATAAAGCAGAGAGACAGCTAGG - Intergenic
923951133 1:238955661-238955683 AAAACTTCACAAGGACAGTTGGG - Intergenic
1063135155 10:3209599-3209621 AAAAATGGAGAGAGACAGCAAGG - Intergenic
1063396732 10:5694823-5694845 AAAACCACAAAGGGGCAGCTGGG - Intronic
1065730431 10:28705184-28705206 ACAGCTGCAAAGTGACAGCTGGG - Intergenic
1066786341 10:39008225-39008247 AAATCTGCAAAGGGACATTTGGG - Intergenic
1066786365 10:39008568-39008590 GGATCTGCAAAGGGACAGCTGGG - Intergenic
1066790364 10:39055681-39055703 AAATCTACAGAGGGACATTTTGG + Intergenic
1066795829 10:39119530-39119552 GAAACTGCAAAGGGACAATTGGG + Intergenic
1066796162 10:39123673-39123695 GAAACTGCAAAGGGACATTTGGG + Intergenic
1066796700 10:39130011-39130033 GAACCTGCAAAGGGACAGTTGGG + Intergenic
1066796903 10:39132200-39132222 GAATCTGCAAAGGGACAGTTGGG + Intergenic
1066800254 10:39180328-39180350 AAAACTGCAAAGGGATATTTTGG + Intergenic
1067666639 10:48284944-48284966 AGACATGCAGAGGGACAGCTAGG - Intergenic
1069737225 10:70664752-70664774 AAAACTCCCAAAGGACAGCTGGG + Intergenic
1069737260 10:70665011-70665033 AAATGTGCAGAGGGAATGCTGGG + Intergenic
1070076061 10:73137318-73137340 AGAACTGCAGAGAGAAAGATTGG - Intronic
1070349957 10:75582439-75582461 AAAAGGGCCCAGGGACAGCTTGG - Intronic
1070792511 10:79197682-79197704 AAAACTGTAAAGGGAAAGCCAGG + Intronic
1072752057 10:97988157-97988179 AAAGCAGCAAAGGGACAGCAGGG - Intronic
1073036675 10:100568664-100568686 AAAACACTAGAGGGAGAGCTTGG - Intergenic
1077117589 11:892243-892265 AGAACTGCCGAGGCACAGCCAGG + Intronic
1078053944 11:7991864-7991886 AAAACTGCAGAGGGACAGCTTGG - Intronic
1078397165 11:10991495-10991517 AAAACTGCAGAGAGCCAGGCAGG - Intergenic
1080198439 11:29639313-29639335 AACTCTGCAAAGTGACAGCTTGG - Intergenic
1081651010 11:44824245-44824267 AATACTACATAGTGACAGCTAGG - Intronic
1082711737 11:56561095-56561117 AAAAGTGCCAAGGTACAGCTTGG + Intergenic
1083327795 11:61881967-61881989 AAAAGGGCAGAGGGAAGGCTGGG + Intronic
1084078457 11:66801117-66801139 AAACATGCAGAGGGACAACAAGG - Intronic
1084123858 11:67085814-67085836 AAAACTGCTGAGGGGCAGAGGGG + Intergenic
1085291848 11:75406327-75406349 AAAACTAGTGAGGGACAGGTTGG + Intronic
1085395465 11:76205048-76205070 AGAACTCCTCAGGGACAGCTGGG + Intronic
1085500307 11:77015810-77015832 TAAATTGCAGAGGCACAGCCAGG + Intronic
1087127050 11:94638746-94638768 AAGACTGCAGAAGGACTGGTTGG + Intergenic
1087911288 11:103756618-103756640 AAGACTGCAGTGGGACTGTTTGG - Intergenic
1088319375 11:108539506-108539528 AAAACTTCTGAAGGACAGCATGG - Intronic
1089296730 11:117473674-117473696 AAAACTACAGATGGGGAGCTGGG - Intronic
1089337087 11:117732673-117732695 AGGTCTGCAGAGGGATAGCTGGG + Intronic
1091143738 11:133258902-133258924 AAAACTGCAGTGGAACAGCAGGG + Intronic
1091379132 12:44567-44589 AGAACAGCAGAGGGCCAGCGTGG - Intergenic
1093219120 12:16398236-16398258 GGAACTGCAGTGGGACAGGTGGG + Intronic
1094827553 12:34282851-34282873 CAAACTGCAAAGGGACATTTTGG - Intergenic
1094839658 12:34337622-34337644 AAAACTGTAGAGGCAGAGCAGGG + Intergenic
1094839771 12:34338014-34338036 AAAACTGGCGAGGCACAGCAGGG + Intergenic
1094840987 12:34342652-34342674 AGAACTGCCGAGGGAGAGCAGGG + Intergenic
1094857330 12:34413405-34413427 CAATCTGCAGAGGGATATCTGGG - Intergenic
1094857346 12:34413747-34413769 GAAACTGCAGAGGGATATTTTGG - Intergenic
1094876482 12:34650424-34650446 GAAACTGCAGAGGGATATTTGGG + Intergenic
1095069294 12:37820404-37820426 AAAACTGCAAAGGGACATTTGGG + Intergenic
1095962850 12:47846253-47846275 AGACCTGCTGAGGGCCAGCTGGG - Intronic
1096567699 12:52495103-52495125 GAAAGTGCAGAGGGACACCCAGG - Intergenic
1096750364 12:53755041-53755063 AAAACAGGAGAGGGAGGGCTTGG + Intergenic
1098601623 12:72338175-72338197 AAAGCTTCAGAGGAAAAGCTTGG - Intronic
1099002099 12:77190766-77190788 AAAACTACAGGGGGATTGCTTGG - Intergenic
1099527287 12:83731139-83731161 AAAACTGTAGAAGAAAAGCTAGG - Intergenic
1102205353 12:111086769-111086791 AAAAGTGATGAGGCACAGCTGGG + Intronic
1102717810 12:114989317-114989339 AAAACTGCAACCGGACAGCCTGG + Intergenic
1102787434 12:115616288-115616310 CAAACTGCAGAGGGAATGCTAGG - Intergenic
1104266703 12:127240140-127240162 ACAAATGGAGAGGGAGAGCTGGG - Intergenic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1106542562 13:30703354-30703376 TAAACTCCAGGGGGACAGCTAGG + Intergenic
1107565481 13:41599567-41599589 AAAACTGTTGAGGAACAGATTGG + Intronic
1107986617 13:45781804-45781826 AAAATTGCAGATGGCCAGCCAGG + Exonic
1108317908 13:49255839-49255861 AAAAATGAAGAGGGAAAGCATGG + Exonic
1108423894 13:50278438-50278460 AAAAATGAACAAGGACAGCTTGG + Intronic
1109091505 13:58052148-58052170 AAAACGGCCCAGGTACAGCTTGG + Intergenic
1110148652 13:72223927-72223949 AGAACTGCAGCAGGACAGGTTGG - Intergenic
1111105628 13:83642262-83642284 AAAACTTCAGGGGGACTGTTGGG - Intergenic
1111404125 13:87779756-87779778 AAAACTGAAGAAAGACAGCCAGG - Intergenic
1112714740 13:102170633-102170655 AACATTGCTGAGGGACATCTCGG - Intronic
1113040101 13:106095463-106095485 AATACTGCAGAGGTTCACCTGGG - Intergenic
1113075309 13:106462205-106462227 GAAGTTGCAGAGAGACAGCTTGG + Intergenic
1113341792 13:109432894-109432916 AAAAGGGCAAAGGTACAGCTCGG - Intergenic
1113793525 13:113043234-113043256 AAACCTGCAGGTGGGCAGCTTGG + Intronic
1114298419 14:21351632-21351654 GGAACTGCAGTGGGACAGGTGGG + Exonic
1115435098 14:33363076-33363098 AAAACAGAAGCAGGACAGCTCGG - Intronic
1116210186 14:41928400-41928422 AAAACTGGAGAGGGCCTGCGTGG - Intergenic
1117025182 14:51611975-51611997 AAAACTGCATAGAGAAAACTGGG + Intronic
1117376521 14:55123025-55123047 GAATCTGCAGAGGGACAGGTAGG + Intergenic
1118994448 14:70823219-70823241 ATAGCTGCAGAGTGACAGCAGGG - Intergenic
1119781463 14:77279010-77279032 GAAACTGGAGAGGAGCAGCTGGG + Intronic
1122598737 14:102910287-102910309 TAGACTGCAGAAGGAGAGCTAGG + Exonic
1122634298 14:103123029-103123051 AACACTTCAGAGGGGCGGCTGGG + Intergenic
1122667244 14:103339620-103339642 AAAACTGCAAATAGACACCTTGG - Exonic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1124384521 15:29195386-29195408 GAAACTGCAGAGAGCCACCTCGG - Intronic
1124991101 15:34674595-34674617 AGCAGTGCAGAGCGACAGCTGGG + Intergenic
1125887571 15:43240123-43240145 AAAAAGGCAGAAGGAAAGCTAGG - Intronic
1126178226 15:45758830-45758852 AAAACTGCATATGGCCTGCTGGG - Intergenic
1126575492 15:50192400-50192422 ATGCCTGCAGAGGGCCAGCTGGG + Intronic
1127799393 15:62464821-62464843 AAAAATGCAGAGTGAGTGCTAGG - Intronic
1128704097 15:69826020-69826042 AAAATTGGAAAGAGACAGCTGGG - Intergenic
1128887311 15:71300436-71300458 AAAGCCACATAGGGACAGCTGGG + Intronic
1130025845 15:80269754-80269776 GATACAGCAGAGGGAGAGCTGGG - Intergenic
1130533294 15:84764247-84764269 AAAACTTAGGAGGGAAAGCTTGG + Intronic
1132448366 15:101950552-101950574 AGAACAGCAGAGGGCCAGCGTGG + Intergenic
1133320946 16:4913532-4913554 AAAACCACAGAGGCAGAGCTGGG - Intronic
1136226768 16:28865144-28865166 AAAACATCACAGGGAGAGCTGGG - Intronic
1136317146 16:29460997-29461019 AACTCTGCAAAGGGGCAGCTGGG + Intronic
1136431721 16:30200339-30200361 AACTCTGCAAAGGGGCAGCTGGG + Intronic
1137569014 16:49552551-49552573 ATTACTGCAGAGGGAAATCTCGG + Intronic
1137571900 16:49571840-49571862 AACACTGCAGAGGGCAAGTTGGG + Intronic
1137576917 16:49606137-49606159 AAAGCTGCAGAAGGACATGTAGG + Intronic
1138961636 16:62035793-62035815 AAAACTGGAGGGGCACAGCCTGG + Intronic
1140562191 16:75996553-75996575 ATCACTGTAGAGGGTCAGCTTGG + Intergenic
1141404236 16:83777530-83777552 AAAACTGCTGAGAAGCAGCTTGG + Intronic
1141699139 16:85634468-85634490 GAGGCTGCAGAGGGAGAGCTGGG + Intronic
1143537390 17:7549356-7549378 GAGACTGCAGAGGGGCCGCTGGG + Intronic
1145730467 17:27179524-27179546 GAATCTACAGAGGGACAGTTTGG + Intergenic
1146304800 17:31722721-31722743 AAGAGGGCAGAGGGAGAGCTTGG + Intergenic
1147450155 17:40499473-40499495 TCAAGTGCAGAGGGACACCTGGG + Intronic
1148662799 17:49348869-49348891 AAAAATGCATAGGGATAACTTGG - Intronic
1150224959 17:63519455-63519477 AGAACTGGAGAGGGACCCCTGGG - Intronic
1150507221 17:65711617-65711639 AAAGCTGGAGAGTGCCAGCTTGG - Intronic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154425258 18:14267223-14267245 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1154432954 18:14322462-14322484 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155171393 18:23269312-23269334 AGAAGTGCAGAGGGAAAGGTGGG - Intronic
1157838570 18:50932597-50932619 AAAAATGCAGAGGAACAGAATGG + Intronic
1158659912 18:59377388-59377410 AAAACTTGAGAGGGACAGAGTGG + Intergenic
1160636901 19:82001-82023 AGAACAGCAGAGGGCCAGCGTGG - Intergenic
1164361915 19:27522267-27522289 AAATCTGCAGAGGGACATTTGGG + Intergenic
1164363647 19:27548078-27548100 GAATCTGCAAAGGGACAGTTGGG + Intergenic
1164370047 19:27636216-27636238 TAAACTGCATAGGGTCAGCAAGG + Intergenic
1164373468 19:27662298-27662320 AAATCTACTAAGGGACAGCTGGG - Intergenic
1165644049 19:37418270-37418292 AAAACTGGAGAGGCCCACCTAGG + Intronic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
924975496 2:170869-170891 TAATCTGCAGAAGCACAGCTTGG - Intergenic
925001576 2:407048-407070 ACACCTGCAGTTGGACAGCTGGG - Intergenic
925422132 2:3721135-3721157 AAACCTGTAGAGGGACATATAGG - Intronic
926537037 2:14125792-14125814 AAACCTTCAGAAGGGCAGCTGGG - Intergenic
926951067 2:18243994-18244016 AAATCTTCAGTGGAACAGCTGGG + Intronic
929539901 2:42811253-42811275 AAATCTGCCCAGGGACGGCTGGG - Intergenic
931127501 2:59294297-59294319 AAAAATGCAAAGGGAAAACTTGG - Intergenic
932802348 2:74752121-74752143 CCCACAGCAGAGGGACAGCTGGG - Intergenic
933422399 2:82066373-82066395 GAAAATGCAGGGGGATAGCTGGG - Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
936564575 2:113573040-113573062 AGAACAGCAGAGGGCCAGCGTGG + Intergenic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
939214873 2:139223067-139223089 ATAAGTGGAGAGAGACAGCTTGG - Intergenic
939504309 2:143026886-143026908 TTGACTTCAGAGGGACAGCTTGG - Intronic
939656304 2:144830451-144830473 AAAACAGCAGAGTGACTGCCTGG + Intergenic
941036492 2:160574554-160574576 AGAACTGAGGAGGGTCAGCTGGG + Intergenic
941791545 2:169557682-169557704 AAAACTGAATAGGAACATCTAGG + Intronic
943453085 2:188070525-188070547 AAAACTGTAGAGGAAAACCTTGG - Intergenic
943514483 2:188867305-188867327 AAAACTGTAGAAGAAAAGCTAGG + Intergenic
944885307 2:204056894-204056916 AAAACCGCAGATGCGCAGCTGGG - Intergenic
945194948 2:207228855-207228877 AAATCTGCTGGGGGACAGCAGGG + Intergenic
946837799 2:223789542-223789564 AAAACTATAGAGGGAGTGCTGGG + Intronic
948900605 2:240955099-240955121 AAAGCTGCAGATACACAGCTGGG - Intronic
1168850955 20:976670-976692 AAAAATGCAGGGTGACATCTGGG + Intronic
1170163605 20:13341034-13341056 AAATCTGCAGACCTACAGCTTGG + Intergenic
1171146020 20:22783495-22783517 AAAGCTGCAGAGGAAAAGTTGGG + Intergenic
1172159070 20:32852673-32852695 AAAACTACAGAGGATCACCTTGG - Intergenic
1172664834 20:36591791-36591813 GAAACAGCACAGGGGCAGCTTGG - Exonic
1174992928 20:55533709-55533731 AATACTGCATAGGAACAGCCAGG + Intergenic
1175204363 20:57300541-57300563 AAAGCTGCAGAGGTACAGTCGGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1179404059 21:41110954-41110976 ATAAAGGCAGAGGGAGAGCTGGG + Intergenic
1180718650 22:17890280-17890302 AAAGCAGCACAGGGACAGCGCGG - Intronic
1181772311 22:25134695-25134717 AAAGCTGCAGAGCGGCAGCATGG - Intronic
1181935688 22:26436690-26436712 AAAACTTCAGAATGACATCTGGG + Intronic
1183216236 22:36481991-36482013 CAAATTGGAGAGGGACAGATGGG - Exonic
949844477 3:8356028-8356050 AAAACAGAGGAGGGTCAGCTTGG - Intergenic
950399474 3:12759413-12759435 AACACTGCGGAGGGGCAGGTGGG + Exonic
950675052 3:14549679-14549701 AAATCTGTAGAGTGCCAGCTGGG - Intergenic
950855619 3:16101960-16101982 AAAGCTTCAGAGGGACACGTGGG + Intergenic
951058241 3:18173151-18173173 AAAAGGGCAAAGGTACAGCTTGG - Intronic
951297323 3:20954471-20954493 AAATCTGAAGATGGACCGCTGGG - Intergenic
951801903 3:26605177-26605199 AAAACTGAAAAGGGACAGTGGGG + Intergenic
952900500 3:38108956-38108978 AGAACCACAAAGGGACAGCTAGG - Intronic
954782757 3:53073169-53073191 AACACTGCAGAGAGAGAGCCTGG + Intronic
955025969 3:55167819-55167841 CAAACTGCAGAGCTGCAGCTGGG + Intergenic
960071898 3:113440554-113440576 GGAACTACAGAGGGACAGCAGGG - Intronic
961013667 3:123450935-123450957 AGAACTCCAGCAGGACAGCTTGG - Intergenic
961202049 3:125053118-125053140 AAAAATGCTGAGGGAGAGCCGGG + Intronic
962531981 3:136290653-136290675 AAAACTACACAGAGAAAGCTAGG - Intronic
962573546 3:136735419-136735441 AAAAATGCAGAGGCAAGGCTGGG - Intronic
962786692 3:138775256-138775278 AAAACTGCAGAGGGACAAAGTGG + Intronic
965991302 3:174821881-174821903 TAAACAGAAGAAGGACAGCTAGG + Intronic
968454518 4:690146-690168 AAGACTGCACAGTGAAAGCTGGG - Intergenic
968913488 4:3487181-3487203 ACACCTGCAGAGGCACAGCTTGG - Intronic
971932822 4:33107103-33107125 AAAACTGGAGAGAGACATCTAGG - Intergenic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
973816392 4:54623270-54623292 AAAACTGCAGGGGGCCAGGAAGG - Intergenic
975287591 4:72638202-72638224 AAAACTGTAGAGGAAAACCTAGG + Intergenic
975567277 4:75771557-75771579 AAAATTGCAGAGGTAGAGTTTGG - Intronic
976194330 4:82518478-82518500 AAAGCTGTAAAGGGACAGCCAGG - Intronic
978160238 4:105538279-105538301 AAAACAGCAGAGGGAAAACCTGG + Intergenic
978882469 4:113722720-113722742 AACTCTGCAGAGGGAAAGCTGGG - Intronic
980651237 4:135717613-135717635 CCAACTGCAGAAGAACAGCTTGG + Intergenic
981302823 4:143208960-143208982 AAAAAAGTAAAGGGACAGCTGGG - Intronic
981909031 4:149956453-149956475 ACAAATGCAGAGGGAAACCTGGG + Intergenic
982086684 4:151842798-151842820 ACAGCTGCAGAGGGACAATTGGG - Intergenic
985299152 4:188469342-188469364 AAGACTGGTGAGGGCCAGCTCGG + Intergenic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
986407943 5:7445298-7445320 TAAACTGCACTGGGCCAGCTGGG - Intronic
986652146 5:9974728-9974750 AAAGCTACAGAGGGACACATAGG + Intergenic
986796755 5:11220106-11220128 AAAACAGAAGAGGGACATATAGG + Intronic
988543816 5:32137705-32137727 AAAAATCCAGAGGGAGAGATGGG + Intronic
988653210 5:33176635-33176657 AAAGCAGCAGTGGGACAGATGGG + Intergenic
989284870 5:39687866-39687888 AAAATTCCAGAGGAACAGTTGGG - Intergenic
989841010 5:46069697-46069719 GAAACTGCAGTGGGACATTTGGG + Intergenic
990342242 5:54834896-54834918 AAAACTGAAGATGGACAAGTTGG - Intergenic
992084270 5:73263905-73263927 GGATCTGCAGAGGGAGAGCTTGG + Intergenic
997378110 5:133412667-133412689 AGAACTGGAGAGGGACACATGGG - Intronic
997856812 5:137380083-137380105 TAAACTCCAGACCGACAGCTTGG + Intronic
998885220 5:146686942-146686964 AAAACTGCATAGGGACCTCAAGG + Intronic
999403783 5:151288419-151288441 AACACTGCAGAAGCCCAGCTGGG + Exonic
999552194 5:152701555-152701577 CAATCTGCAGAGGCAGAGCTGGG - Intergenic
1001041506 5:168338823-168338845 AAAGCTGCAAAGGGAGAGTTAGG + Intronic
1002040991 5:176514119-176514141 GCAACTGCAGAGGGACAGAATGG - Intergenic
1002553069 5:180011938-180011960 AAAAGTGCACAGGGAGAGCCTGG + Intronic
1002603621 5:180369472-180369494 AAAAGTTCAGAGGAAGAGCTGGG + Intergenic
1002670934 5:180866552-180866574 AAGACAGAACAGGGACAGCTGGG + Intergenic
1004008145 6:11655781-11655803 AAAATTGCTGAGGGAAAGCCTGG + Intergenic
1004067246 6:12260685-12260707 GAAACTCCAGAGGGACAGGGGGG - Intergenic
1005604999 6:27467691-27467713 AAAGCTGGAGAGGCACAGCTAGG + Intronic
1006028773 6:31164212-31164234 ACAACATCAGAGGGAGAGCTGGG - Exonic
1007376328 6:41459365-41459387 TAAACTGAAGGGGGACAGATGGG + Intergenic
1009253762 6:61348158-61348180 GAAACTGCAGAGGGACATTTGGG + Intergenic
1009258448 6:61449979-61450001 GAAACTGCAGAGGGACATTTGGG + Intergenic
1010572798 6:77498257-77498279 AAAACTGCAGAGAGTGACCTGGG - Intergenic
1011211894 6:84964435-84964457 GATACAGCAGAGAGACAGCTTGG + Intergenic
1014528259 6:122527095-122527117 GAAACTGCAGAAGAAAAGCTGGG - Intronic
1014661596 6:124179599-124179621 CAGACAGCAGAGGGACTGCTGGG + Intronic
1017011842 6:150068709-150068731 AAAGCTGCAGAGGGCGAGGTGGG - Intronic
1018254613 6:161905586-161905608 AAAATTCCAGAAAGACAGCTTGG - Intronic
1018665394 6:166132024-166132046 AAAACTGCAGTAGGATAGCAGGG + Intergenic
1019352489 7:561543-561565 CAAACGGCAGAGGGACAGCTCGG - Intronic
1020771652 7:12403494-12403516 AAGACAGCAGAGGGACAGAGAGG + Intronic
1021728575 7:23574402-23574424 CTGTCTGCAGAGGGACAGCTAGG + Intergenic
1021759390 7:23888690-23888712 AAAACAGCAGGGGGACAGAGAGG + Intergenic
1022495734 7:30851966-30851988 AAGACTGCAAAGGGAGAGCTTGG - Intronic
1022611597 7:31880296-31880318 AAGACTGAAGAGGGAATGCTGGG + Intronic
1022699683 7:32747623-32747645 TAAACTGCTGCGGGAAAGCTGGG - Intergenic
1023424867 7:40024957-40024979 AAAACCACAGAGCTACAGCTGGG - Intronic
1024259209 7:47561100-47561122 CAAACTTCAGAGGGTAAGCTAGG + Intronic
1024629670 7:51236678-51236700 TGAGCTGCAGAGGGACAGCTGGG - Intronic
1024879752 7:54071850-54071872 AAAACTCCAGAGGTAGAACTGGG + Intergenic
1025533511 7:61919726-61919748 AAATCTCCAGAGGGACATTTTGG + Intergenic
1025533615 7:61920709-61920731 AAATCTGCAAAGGGACATGTGGG + Intergenic
1025536144 7:61950125-61950147 CAATCTGCAGAGGGACATTTGGG - Intergenic
1026081544 7:67226144-67226166 AAGAATGAAGAAGGACAGCTTGG - Intronic
1026285343 7:68957793-68957815 AAAACTGAAGAGCAACTGCTAGG - Intergenic
1026695531 7:72587853-72587875 AAGAATGAAGAAGGACAGCTTGG + Intronic
1028827205 7:95287538-95287560 AATAGTGCAAAGGGACAGGTTGG - Intronic
1029090059 7:98040889-98040911 ACACCTGCAGAGGGCCAGCAGGG - Intergenic
1032252874 7:130272863-130272885 AAAACTGCAAAGAGCCGGCTGGG + Intronic
1032947192 7:136868448-136868470 GAAATTGCAGATGGAGAGCTGGG + Intergenic
1033636643 7:143218146-143218168 AAAACTGAAGAGGGAGAGACGGG + Intergenic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1034390776 7:150785967-150785989 AAAACTGCACAGACACAGATGGG - Intergenic
1034721969 7:153301661-153301683 TAAACTGAAGGGAGACAGCTTGG + Intergenic
1034783471 7:153903477-153903499 AAAACTGCCCAGGGTCACCTAGG + Intronic
1034885832 7:154798157-154798179 AGAACTGCAGGTGGCCAGCTGGG - Intronic
1036497489 8:9282745-9282767 CAAAAAGCAGAGGGGCAGCTTGG + Intergenic
1040113015 8:43580893-43580915 AAAATTGCAAAGGGACATGTGGG + Intergenic
1040118276 8:43650290-43650312 GAAACTGCAAAGGGACATTTGGG + Intergenic
1040121610 8:43690103-43690125 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040127652 8:43756361-43756383 AAATCTGCAAAGGGACATTTTGG + Intergenic
1040128773 8:43769809-43769831 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040128844 8:43770663-43770685 AAATCTGCAAAGGGACATTTGGG + Intergenic
1040129984 8:43784139-43784161 AAATCTGCAAAGGGACATTTGGG + Intergenic
1040130132 8:43785860-43785882 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040130174 8:43786377-43786399 AAATCTGCAAAGGGACATTTTGG + Intergenic
1040133479 8:43825352-43825374 GAAACAGCAAAGGGACATCTGGG + Intergenic
1040134693 8:43839202-43839224 GAATCTGCAGAGGGACATTTGGG + Intergenic
1040135516 8:43848959-43848981 AAATCTGCAAAGGGACAGTTAGG + Intergenic
1040138049 8:43878495-43878517 AAATCTGCAAAGGGACATATGGG - Intergenic
1040274796 8:46004225-46004247 GAAACTGCAAAGGGACAATTGGG + Intergenic
1040282746 8:46073766-46073788 GAATCTGCAGAGGGACATTTTGG + Intergenic
1040321723 8:46312939-46312961 GAAACTGCACAGGGACATGTTGG - Intergenic
1040332457 8:46394541-46394563 AAATCTGCAAAGGGACATTTAGG - Intergenic
1040347641 8:46523591-46523613 AAATCTGCAAAGGGACATTTTGG + Intergenic
1042265039 8:66899789-66899811 AAAAAAGCATAGAGACAGCTGGG - Intronic
1043791220 8:84469737-84469759 CAAACTGCAAGGGGGCAGCTAGG - Intronic
1045563971 8:103295132-103295154 AAAACTCCAGGGGGTCAGCTGGG + Intergenic
1046962010 8:120122650-120122672 AAAACTGCATATGAACATCTGGG - Intronic
1047400968 8:124547083-124547105 GAAACTGCGGAGGGAAAGCTGGG + Exonic
1047709620 8:127538609-127538631 GATACTCCAGAGGAACAGCTGGG + Intergenic
1048378165 8:133840780-133840802 AAACCTGCACAGAGACAGCCAGG - Intergenic
1048402644 8:134086388-134086410 ACAACTGGGGAGGGATAGCTAGG + Intergenic
1049328981 8:142039654-142039676 AAGACTGCAGAAGGACAGGTGGG - Intergenic
1050067863 9:1779571-1779593 AAAACTGTAGAAGGAAACCTAGG - Intergenic
1051404675 9:16723219-16723241 AAAACTGCAGAAAGCAAGCTAGG + Intronic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057081748 9:92178760-92178782 AGAGCTGCAGAGGGGCAACTTGG + Intergenic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057227408 9:93299646-93299668 CAAAGTCCAGAGGGACGGCTGGG + Intronic
1057529572 9:95832070-95832092 AAAACTCCAGAGGGACTCCCTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057880338 9:98788271-98788293 ACAACAGAAGAGGCACAGCTCGG + Intronic
1058975088 9:110118630-110118652 AAAAATACAGAGAGACAGGTGGG - Intronic
1059058635 9:111011952-111011974 AAAAATGCAGAGTCTCAGCTAGG + Intronic
1060068244 9:120523956-120523978 AAACCTGGAGAGGAGCAGCTGGG + Intronic
1060300950 9:122374282-122374304 AATAATGGAGAGGGACAGATTGG + Intronic
1060744175 9:126119258-126119280 AAAAATGCAGAGGCCCGGCTGGG - Intergenic
1060966908 9:127716650-127716672 AGGACTGCAGAGGGACAGGTTGG + Exonic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185630294 X:1511980-1512002 AAAAAGGCAGAGGAACAGGTGGG - Intronic
1186331336 X:8537613-8537635 AAAAGTGCAGATGGATAGCTGGG + Intronic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1188878415 X:35461526-35461548 AAACCTGGAGAGAGACACCTGGG - Intergenic
1189878012 X:45456812-45456834 AAGCCTGCAGTGGGAGAGCTGGG - Intergenic
1191259853 X:58305304-58305326 GAAACTGCAAAGGGACATTTGGG + Intergenic
1191260477 X:58314104-58314126 AAATCTGCAAAGGGACATTTGGG + Intergenic
1191583639 X:62794632-62794654 AAATCTGCAAAGGGACATTTAGG - Intergenic
1192554816 X:72081062-72081084 AAAACTCCAGAGACACAGCATGG - Intergenic
1193961641 X:87932820-87932842 AAAATTGCTGAGGGACAGCTTGG - Intergenic
1195960463 X:110380984-110381006 AAAACTCCAGAAGGAAACCTGGG + Intronic
1196398713 X:115291624-115291646 AGAAATGAAGAGGGTCAGCTGGG + Intronic
1196606332 X:117661607-117661629 AAAACTCCAGAAGAAAAGCTAGG + Intergenic
1197997956 X:132400348-132400370 AAAGCAGCAAAGGGACTGCTAGG + Intronic
1199943693 X:152649026-152649048 AAAACTGCAGGGTGTCAGATGGG - Intronic
1200252333 X:154560227-154560249 ACAACTGCAGGGGGCCAGGTGGG - Intronic
1200265435 X:154644189-154644211 ACAACTGCAGGGGGCCAGGTGGG + Intergenic
1201366330 Y:13210793-13210815 AAAGATGCAGAGTGGCAGCTGGG - Intergenic
1201431274 Y:13904990-13905012 AAAAGTGCAGATGGATAGCTGGG - Intergenic
1201777079 Y:17677725-17677747 GAATCTGCAGAGGGACATTTGGG - Intergenic
1201824478 Y:18228267-18228289 GAATCTGCAGAGGGACATTTGGG + Intergenic