ID: 1078054300

View in Genome Browser
Species Human (GRCh38)
Location 11:7994727-7994749
Sequence TGTGAATGGTATGTGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078054300_1078054306 15 Left 1078054300 11:7994727-7994749 CCAGAGGCCACATACCATTCACA 0: 1
1: 0
2: 0
3: 13
4: 234
Right 1078054306 11:7994765-7994787 TGATGAGCATACCAGGTAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 192
1078054300_1078054303 -8 Left 1078054300 11:7994727-7994749 CCAGAGGCCACATACCATTCACA 0: 1
1: 0
2: 0
3: 13
4: 234
Right 1078054303 11:7994742-7994764 CATTCACATGAGATCAAAACCGG 0: 1
1: 0
2: 1
3: 22
4: 186
1078054300_1078054304 8 Left 1078054300 11:7994727-7994749 CCAGAGGCCACATACCATTCACA 0: 1
1: 0
2: 0
3: 13
4: 234
Right 1078054304 11:7994758-7994780 AAACCGGTGATGAGCATACCAGG 0: 1
1: 0
2: 1
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078054300 Original CRISPR TGTGAATGGTATGTGGCCTC TGG (reversed) Intronic
901665804 1:10825599-10825621 TGTGTAAGTCATGTGGCCTCAGG - Intergenic
902079434 1:13811271-13811293 TGTGAAGGTTAAGGGGCCTCTGG + Intronic
907734636 1:57100256-57100278 TTTGAATGGTATGTGGCACATGG + Intronic
907879742 1:58536362-58536384 TGTGAAAGGTCTGAGGCCTTCGG + Intronic
907885557 1:58589380-58589402 TGTGCCTGCTATGCGGCCTCAGG - Intergenic
908181202 1:61607701-61607723 TGTAAATGGGATCTGTCCTCAGG - Intergenic
909559248 1:76991323-76991345 TGTAATTGATATATGGCCTCAGG - Intronic
911726863 1:101250971-101250993 TGTGAATGGTGTCTGTCCTAAGG - Intergenic
915282732 1:154833619-154833641 TGTTACTGGTGTGTGGCCTTGGG - Intronic
915522237 1:156453947-156453969 TGTGTGTTGTATGTGGCCACAGG - Intergenic
916340564 1:163728931-163728953 TGTGAATCATATGAAGCCTCTGG - Intergenic
918650672 1:186958628-186958650 GGGGAATGGTATGTGGCCAAGGG - Intronic
919338891 1:196277494-196277516 TGGAAGTGGTCTGTGGCCTCTGG - Intronic
920940040 1:210473540-210473562 GGTGAATGGTGTGGGGCCACTGG + Intronic
921186010 1:212670055-212670077 TGTGAAGGGTGTGTGGCCAGAGG - Intergenic
1062870304 10:896387-896409 TGTGAAGGAAATCTGGCCTCAGG - Intronic
1064268278 10:13842555-13842577 TGTAGATGGTCTGTGGCCTTGGG - Intronic
1065587296 10:27232051-27232073 TATGAATGGTCTGTAGTCTCTGG - Intronic
1066293110 10:34031632-34031654 TGTGCTTGGCATGAGGCCTCTGG - Intergenic
1066815049 10:39396726-39396748 TCTGAATGGTTTGAGGCCTATGG + Intergenic
1066934700 10:41813230-41813252 TGTGAGTGCTATGTGGCCTAGGG - Intergenic
1069534195 10:69241106-69241128 TGTGAGTGGGATGAGGCGTCAGG + Intronic
1070741341 10:78905218-78905240 TCTGCATGGTATGTGGTGTCAGG + Intergenic
1072015719 10:91344342-91344364 TCTAAATGGTATGTTGCCTCAGG - Intergenic
1072887632 10:99293116-99293138 TGTGAGTGGTATGTGGGGTATGG - Intergenic
1073353788 10:102837676-102837698 TGCGAATGGTATCTGGGCTCAGG + Intergenic
1076588574 10:131568001-131568023 TGTGGGAGGTGTGTGGCCTCTGG - Intergenic
1078054300 11:7994727-7994749 TGTGAATGGTATGTGGCCTCTGG - Intronic
1078483628 11:11702092-11702114 TGTGAGTGGTATGGGGGCTTTGG - Intergenic
1081691191 11:45079844-45079866 TGTCCATGGTGTGTGGCCTCAGG + Intergenic
1082149709 11:48721462-48721484 TGTGAGTGCTTTGAGGCCTCTGG + Intergenic
1082151363 11:48744145-48744167 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1082154356 11:48786532-48786554 TGTGAATGGTTTAAGGCCTATGG - Intergenic
1082599008 11:55125905-55125927 TGTGAGTGGTTTGAGGCCTGTGG + Intergenic
1082599094 11:55127452-55127474 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1082599506 11:55132289-55132311 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1082600376 11:55143602-55143624 TTTGAGTGGTTTGTGGCCTCTGG - Intergenic
1084341657 11:68507805-68507827 TGTGTATGATATGTGCTCTCAGG + Intronic
1085482129 11:76831303-76831325 TGTGAAGGGAAAGTGGGCTCTGG + Intergenic
1094129236 12:27057019-27057041 TGTGAATGGTGTGTTGTCGCAGG + Intronic
1094363193 12:29652091-29652113 TGTGAAAGGTCTATGCCCTCTGG + Intronic
1095061900 12:37705297-37705319 TGTGAGTCCTTTGTGGCCTCGGG - Intergenic
1095063917 12:37741322-37741344 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1095064185 12:37746289-37746311 TGTGAACGGTTTGCGGCCTATGG + Intergenic
1095065906 12:37774237-37774259 TGTGAATGCTTTGAGGCCTGTGG + Intergenic
1095067332 12:37793700-37793722 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1095067693 12:37800900-37800922 TGTGAGTGGTTTGAGGCCTGTGG + Intergenic
1095178726 12:39122860-39122882 TGGGAATGGGGTGAGGCCTCTGG - Intergenic
1100301984 12:93316007-93316029 TGTCCATTGTATGTGGCCTTGGG + Intergenic
1100451736 12:94713069-94713091 TGTGAATCCTCAGTGGCCTCTGG + Intergenic
1101155121 12:101920139-101920161 TGTGAATGGACAGTGGCCTTTGG + Exonic
1102582337 12:113897882-113897904 TGGGAATGGGATGTGGCCAGAGG - Intronic
1105085709 13:16193532-16193554 TGTGAGTGGTTTATGGCCTACGG + Intergenic
1106095541 13:26640042-26640064 TGTGATAGGTGTGTGGGCTCTGG + Intronic
1110235774 13:73216409-73216431 TGACTATAGTATGTGGCCTCTGG - Intergenic
1111055284 13:82940707-82940729 TGAGAATGGTATATTACCTCAGG + Intergenic
1112138291 13:96608818-96608840 TGTGAATGGAATGGGGTTTCTGG + Intronic
1113996076 14:16073810-16073832 TGTGAGTCCTTTGTGGCCTCAGG + Intergenic
1113996209 14:16076533-16076555 TGTGAGGGGTTTGTGGCCTATGG + Intergenic
1113996370 14:16079898-16079920 TGTGAATGCTTTGAGGCCTATGG - Intergenic
1115656056 14:35444859-35444881 TGTGAATTGGAGGTGGACTCCGG + Intergenic
1116533664 14:46005079-46005101 TGTGAATGAAATGTGGCCCTTGG + Intergenic
1117783629 14:59259636-59259658 TGTCTCTGGTATGTGTCCTCAGG - Intronic
1119891679 14:78187403-78187425 TCTGAATGGCATGTAGACTCAGG - Intergenic
1122149633 14:99717940-99717962 TGTAAATGGCATGTGCCCCCAGG - Intronic
1122208175 14:100158815-100158837 TGTGGGTGGGATGGGGCCTCTGG + Intronic
1124019640 15:25908847-25908869 TGTGAATGGAATGTTTTCTCAGG - Intergenic
1129200433 15:73995199-73995221 TGAGAAGGGTCAGTGGCCTCCGG + Intronic
1129834186 15:78691753-78691775 TGGAAGTGGTATGTGGCCTGAGG + Intronic
1129939225 15:79479277-79479299 GGTGACTGGAGTGTGGCCTCTGG + Intergenic
1131372195 15:91891957-91891979 GGTGAATGGGATTTGGCCTTGGG + Intronic
1131618846 15:94045656-94045678 TGTGGATGGTTTGTGGCTGCAGG + Intergenic
1131999625 15:98165492-98165514 TGTGCGTGCTCTGTGGCCTCAGG + Intergenic
1132945109 16:2528148-2528170 TGTGAGTGCTATGGGGCCCCAGG + Exonic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1136907603 16:34115017-34115039 TGTGAATGTTTTGAGGCCTATGG + Intergenic
1137018815 16:35402083-35402105 TGTGTGTGGTAGGTGGACTCAGG + Intergenic
1137045534 16:35655214-35655236 TGAAAATGGTATGTGACCTGTGG + Intergenic
1137075924 16:35961081-35961103 TGTGAACGGTTTGAGGCCTATGG + Intergenic
1137076693 16:35974202-35974224 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1137077028 16:35980524-35980546 TGTGAATGGTTTGAAGCCTATGG - Intergenic
1140321292 16:73954338-73954360 TGAGAATGGTATTTGGCACCAGG - Intergenic
1143848900 17:9794623-9794645 TCTGACTTGTGTGTGGCCTCAGG + Intronic
1144040232 17:11403966-11403988 TGTGCTTGGGGTGTGGCCTCAGG - Intronic
1145416926 17:22722721-22722743 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1145417669 17:22735291-22735313 TGTGAGTGGTCTGAGGCCTATGG + Intergenic
1145418430 17:22743723-22743745 TGTGAGCGGTATGAGGCCTATGG + Intergenic
1146558822 17:33850609-33850631 TGTTCATGGTATGTTTCCTCTGG + Intronic
1150002122 17:61447542-61447564 TCTGAATGGGATGTGGGCTGAGG + Intergenic
1150302299 17:64056555-64056577 TTTGAGAGGCATGTGGCCTCGGG - Intronic
1151227046 17:72655397-72655419 TGTGACTGGCATGTGTCGTCAGG - Intronic
1152174065 17:78775099-78775121 TGTGGATGGTGTGATGCCTCGGG - Intronic
1152401678 17:80070258-80070280 TGTCTTTGGTCTGTGGCCTCAGG - Intronic
1155103813 18:22640867-22640889 TGAGATTGGTTTGTAGCCTCAGG - Intergenic
1155670272 18:28362387-28362409 TGTAAATGGCATACGGCCTCAGG - Intergenic
1155936170 18:31756812-31756834 TGAGAGTGGTATGAGCCCTCAGG - Intergenic
1158825158 18:61210044-61210066 TGTGAAAGGCATCTGGCCACCGG - Intergenic
1159198408 18:65149333-65149355 TGTGGATGGTCTGTGGCTGCAGG + Intergenic
1159985034 18:74831794-74831816 TGGGAGTGGCATGTGGCATCAGG - Intronic
1160428209 18:78792857-78792879 TGTGGATGGTGCGTGGCCTGTGG + Intergenic
1163156842 19:15444329-15444351 TGTGACTGTTGTGTGACCTCTGG + Intronic
1164037556 19:21467800-21467822 TTTGAATGGCATTTGGACTCAGG + Intronic
1164309029 19:24030354-24030376 TGTGAATGCTATCTGGGCTGGGG - Intergenic
1164327362 19:24208251-24208273 TGGGAATGCAATGAGGCCTCTGG - Intergenic
1164352547 19:27369662-27369684 TGTGACTGGTTTAAGGCCTCGGG - Intergenic
1164355442 19:27421623-27421645 TGTGAGTGGTTTGAGGCCTGTGG + Intergenic
1164356317 19:27435913-27435935 TGTGATTGGTTTGAGGCCTACGG + Intergenic
1164356704 19:27442612-27442634 TGTGAGTGGTAGGAGGCCTAAGG + Intergenic
1165104062 19:33458455-33458477 TGTGTATGGTATGTGGTATGTGG + Intronic
1165870027 19:38965167-38965189 TGTGAATTGTCTGTTTCCTCTGG - Intronic
1165907555 19:39203230-39203252 TGTGAGTGCAAGGTGGCCTCAGG + Intronic
1165932643 19:39369942-39369964 CGTGAATGGTAGGAGGGCTCTGG - Exonic
1166046236 19:40232673-40232695 TGTGCATGGTGTGTGGGCTTGGG - Exonic
1167305976 19:48709704-48709726 TGTGGATGGGGTGTGGGCTCTGG - Intergenic
1167593507 19:50416374-50416396 TGTGACTGCCATGTGGCCGCAGG + Exonic
1167744177 19:51341138-51341160 TGTGTATGGTAAGTGGGCCCTGG - Exonic
1168494014 19:56835456-56835478 TGTGAATGGTGTGTGTCATGGGG - Intronic
925975758 2:9140872-9140894 TCAAAATGGTATGTGGCTTCTGG - Intergenic
930813722 2:55569901-55569923 TGTGATTGGCATCTGGCATCAGG - Intronic
932269323 2:70395677-70395699 TGAGAATGGGATGTTACCTCTGG + Intergenic
934939334 2:98489226-98489248 TCTGAAGGGAATGTGGTCTCGGG + Intronic
937560472 2:123218448-123218470 TGGGAATGGTGTTTGCCCTCTGG - Intergenic
938535976 2:132247771-132247793 TGTGAGTGGTTTGTGGCCTATGG - Intronic
940004235 2:148996854-148996876 TGTGACTGTTAGGTGGCCTGTGG - Intronic
946354145 2:219174433-219174455 TGAGAATGGTCTGTGTCCACAGG + Intronic
947030390 2:225785671-225785693 TGTGTATTGTATGTGGGCTAAGG - Intergenic
948727006 2:239940250-239940272 GGTGAGTGGGATGTGGCCCCCGG + Intronic
948836677 2:240629293-240629315 TGGGACTGGGATGGGGCCTCAGG + Intronic
1171742087 20:28908735-28908757 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1171765927 20:29276284-29276306 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1171765935 20:29276423-29276445 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1171766063 20:29279179-29279201 TGTGAACGGTTTGAGGCCTACGG - Intergenic
1171809345 20:29729305-29729327 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1171863728 20:30457697-30457719 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1171864009 20:30463685-30463707 TGTGAATGGTTTGCAGCCTATGG - Intergenic
1171864116 20:30465739-30465761 TCTGAATGGTTTGAGGCCTATGG - Intergenic
1171864579 20:30474636-30474658 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1173033954 20:39390659-39390681 GGTGAATGTTGGGTGGCCTCAGG - Intergenic
1173307071 20:41860957-41860979 TGTGCATGGAATGTTGCCTTTGG + Intergenic
1173536033 20:43814123-43814145 AGTGAGAAGTATGTGGCCTCAGG + Intergenic
1173952386 20:47003672-47003694 TGTGGATTGGATGTGGCCCCTGG + Intronic
1175090410 20:56498843-56498865 TGTGACTGGTATTTGAGCTCAGG + Intronic
1175550933 20:59817209-59817231 TGTGAATAGTGTGAGCCCTCAGG + Intronic
1175571221 20:60024225-60024247 TGTGAACGCTGTGTAGCCTCAGG + Intronic
1176324799 21:5383292-5383314 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1176482353 21:7313707-7313729 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1176483014 21:7325722-7325744 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1176531543 21:7966408-7966430 TGTTAGTGGTTTGTGGCCTATGG + Intergenic
1176761536 21:10800091-10800113 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1180310691 22:11227248-11227270 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1180310850 22:11230613-11230635 TGTGAGGGGTTTGTGGCCTATGG - Intergenic
1180310983 22:11233337-11233359 TGTGAGTCCTTTGTGGCCTCAGG - Intergenic
1180401198 22:12428255-12428277 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1183361734 22:37386442-37386464 GCTGAATGGGCTGTGGCCTCAGG - Intronic
1183668443 22:39258096-39258118 TGGGGAGGGAATGTGGCCTCAGG - Intergenic
1183835922 22:40453108-40453130 TGTGTTAGGTATGTGGCTTCAGG - Intronic
1185056779 22:48584065-48584087 TGTGAGTGGTGTGTGGTGTCTGG - Intronic
949812636 3:8022503-8022525 TGTGAATGGTATGAGGCAGAGGG + Intergenic
950107252 3:10396175-10396197 TGTGGAAGGAATGTGGCATCTGG - Intronic
952053643 3:29416757-29416779 TGTGATAGGAATGTGGTCTCTGG + Intronic
952853578 3:37749385-37749407 TGTGAATGTTATGTGGCCAGGGG - Intronic
956126015 3:66011548-66011570 TGGGAAGGCTATGTGACCTCAGG - Intronic
957762839 3:84581629-84581651 TGTGAATGGTCTGCTGCCACAGG - Intergenic
958197761 3:90264385-90264407 TGTGAATGGTTTGAGGCCTGTGG - Intergenic
958202836 3:90342799-90342821 TGTGACTGGTATAAGGCCTATGG - Intergenic
958205047 3:90380607-90380629 TGTGACTGGTATAAGGCCTGTGG - Intergenic
964808158 3:160634332-160634354 TGTGAAGGGTCTGAGGCCTGGGG - Intergenic
966436941 3:179897431-179897453 TGTGAATCCTATATGTCCTCGGG - Intronic
967484776 3:190017414-190017436 TGTGTATGCTCTTTGGCCTCTGG - Intronic
970867330 4:20773973-20773995 TGTTAAGTGTATGTGGGCTCTGG + Intronic
972426802 4:38941014-38941036 TGTTAGAGGTAAGTGGCCTCTGG + Exonic
973712429 4:53642969-53642991 AGTCAATGTTAAGTGGCCTCTGG - Intronic
978488742 4:109287462-109287484 TGTGGATGGTAACTGACCTCTGG - Intronic
978932102 4:114326879-114326901 TGTGAATGCTATATGGTCTAAGG - Intergenic
978978033 4:114904023-114904045 TGTGAAAGGCATGTGACATCAGG - Intronic
981118724 4:141022529-141022551 TCTGAATGGTATTTTGCCTTTGG - Intronic
981706635 4:147666299-147666321 TGTCAATGTTCTGTGGCTTCTGG + Intronic
985395212 4:189536735-189536757 TGTGAATAGTATGTGGTAACGGG - Intergenic
987465831 5:18270765-18270787 TGTGAATCATATGTAGCCCCAGG - Intergenic
988828386 5:34963713-34963735 TGTGAATGGTCTGTTGCTGCAGG + Intergenic
989478656 5:41903472-41903494 TGTGAATGCTTTCTTGCCTCTGG - Intergenic
989704418 5:44311433-44311455 CGTGATTAGCATGTGGCCTCTGG + Intronic
989842201 5:46091504-46091526 TGTGAATGCTTTGAGGCCTATGG + Intergenic
989842324 5:46094075-46094097 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
989842358 5:46094754-46094776 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
995227982 5:109725059-109725081 TTTGAGTGGTATGTGTGCTCAGG + Intronic
1000240511 5:159404248-159404270 TGTGAAGGGTCTGGGGCATCTGG + Intergenic
1000373375 5:160558040-160558062 TGGGAATGGTATCAAGCCTCAGG + Intergenic
1002039282 5:176500166-176500188 TGTGAAGTGTATGTAGCATCTGG + Intronic
1002993451 6:2259329-2259351 TGGGAATGGTCTGTGGAATCAGG - Intergenic
1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG + Intronic
1005163596 6:22893876-22893898 AGTGAATGGTACATGGCATCAGG - Intergenic
1007249720 6:40487576-40487598 TGTGAAAGGTGCATGGCCTCTGG + Intronic
1009521227 6:64684169-64684191 TATGAATGGTATCTGACTTCCGG + Intronic
1011715079 6:90096916-90096938 TCTGAAGGGTATGTGACCACAGG - Intronic
1012827293 6:104162663-104162685 ATGGAATGGAATGTGGCCTCAGG - Intergenic
1014066653 6:117134873-117134895 TGTGAGTGGGATGTAGCCACTGG + Intergenic
1014394181 6:120904062-120904084 CATGAATGCTATGTAGCCTCAGG - Intergenic
1016499646 6:144705110-144705132 TGTGAATTGTGTGTGGCCATGGG + Intronic
1018421310 6:163642972-163642994 AGTGAATGGTGAGTGGGCTCGGG + Intergenic
1020153195 7:5699818-5699840 TGGGAAGGCCATGTGGCCTCTGG + Intronic
1021056179 7:16049118-16049140 AGTGAGTGGCATGTAGCCTCAGG - Intergenic
1023310016 7:38876850-38876872 TGTTTATGGTATGTGGCTTAGGG - Intronic
1024013127 7:45287637-45287659 TGTGAATGGTATGTGAAGTGGGG - Intergenic
1024479807 7:49851885-49851907 TGTGAATGCTCTGTGGGGTCTGG - Intronic
1025502344 7:61319985-61320007 TGTGATTGGTTTGAGGCCTCTGG - Intergenic
1025517212 7:61666207-61666229 TGTGATTGGTTTGAGGCCTCTGG - Intergenic
1025519588 7:61706946-61706968 TGTGAGTGGTGTGAGGCCTATGG + Intergenic
1025520795 7:61726811-61726833 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1025522582 7:61757236-61757258 TGTGAGTGCTTTGTGGCCTATGG - Intergenic
1025541548 7:62095031-62095053 TGTGATTGGTTTGAGGCCTCTGG - Intergenic
1025543912 7:62135598-62135620 TGTGAGTGGTGTGAGGCCTATGG + Intergenic
1025545152 7:62156372-62156394 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1025572352 7:62591131-62591153 TGTGAGTGGTATGAGGCCTATGG - Intergenic
1026374960 7:69741055-69741077 TGTGTATGGAGTGTGGCCTGTGG + Intronic
1027757393 7:82231395-82231417 TGTGAATGTTCTGAGGCCTCTGG - Intronic
1032098610 7:128954031-128954053 TCTGAAGGGTCTGTGGCATCAGG + Intergenic
1033992940 7:147310336-147310358 TGTCAATGGTAAATGGCCGCAGG - Intronic
1038465282 8:27756820-27756842 TTTAAATGGCATGTGGCCTGAGG - Intronic
1038514941 8:28179846-28179868 TGTAAATGCTGTGTGGCCTGGGG + Intronic
1039410622 8:37352276-37352298 GGTGAATGGGATGTGGCTCCAGG + Intergenic
1041020281 8:53631881-53631903 TGTGATTGGGGTGTGGGCTCTGG + Intergenic
1041887254 8:62824839-62824861 GGTAAATGGCATGTGGCATCAGG - Intronic
1043478487 8:80628293-80628315 TGTGGAAGGCATGTGTCCTCAGG - Intergenic
1049798723 8:144508121-144508143 TGTGAAGTGTGTGTGGCCTGTGG - Intergenic
1053406651 9:37882665-37882687 TGAGAGTGGTATGAGCCCTCAGG - Intronic
1058359430 9:104125952-104125974 TGTTACTGGTCTGTGGCCTGGGG - Intronic
1058536182 9:105962509-105962531 TGAGAACGCTATGTTGCCTCAGG + Intergenic
1203382544 Un_KI270435v1:70915-70937 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1203383172 Un_KI270435v1:82223-82245 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1203360166 Un_KI270442v1:213409-213431 TGTGAATGTTTTGAGGCCTGTGG - Intergenic
1203402106 Un_KI270519v1:117313-117335 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1203402199 Un_KI270519v1:119026-119048 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1203402796 Un_KI270519v1:129875-129897 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1203682982 Un_KI270757v1:2511-2533 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1185593692 X:1294619-1294641 GGTGAAGGGTCTGTGGCCTGTGG + Intronic
1187272171 X:17789170-17789192 TGTGATTGGACGGTGGCCTCTGG + Intergenic
1189061427 X:37757414-37757436 GGTAAATGGTTTGTGACCTCTGG + Intronic
1189206957 X:39249433-39249455 TGTGAATGTTATGGGGACTGTGG + Intergenic
1191269586 X:58446175-58446197 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1191574646 X:62685740-62685762 TGTGAATGCTTTGAGGCCTATGG + Intergenic
1192308711 X:69990607-69990629 TGTGAATGGGGTGGGGCCACAGG + Intronic
1197078081 X:122377458-122377480 TGTTAATGTTATTTGGCATCTGG + Intergenic
1197965917 X:132061675-132061697 GGGGAATGGGATGTGGCCTAGGG - Intergenic
1199151548 X:144492686-144492708 TGTGAAGGGTTTGTTGCCTTGGG + Intergenic
1199222831 X:145337359-145337381 TGTGCATGATATAGGGCCTCAGG - Intergenic
1201078758 Y:10212029-10212051 TGTGAACGGTTTGAGGCCTATGG - Intergenic
1201079043 Y:10216424-10216446 TGTGAATGCTTTGAGGCTTCTGG + Intergenic