ID: 1078056203

View in Genome Browser
Species Human (GRCh38)
Location 11:8010894-8010916
Sequence AGAGCTTCTAGTGTGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078056203_1078056207 19 Left 1078056203 11:8010894-8010916 CCCAGGAGCACACTAGAAGCTCT No data
Right 1078056207 11:8010936-8010958 GTTCTCTGCTGCAGAAGGCAGGG No data
1078056203_1078056205 14 Left 1078056203 11:8010894-8010916 CCCAGGAGCACACTAGAAGCTCT No data
Right 1078056205 11:8010931-8010953 GAGTAGTTCTCTGCTGCAGAAGG 0: 2
1: 0
2: 8
3: 227
4: 364
1078056203_1078056206 18 Left 1078056203 11:8010894-8010916 CCCAGGAGCACACTAGAAGCTCT No data
Right 1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078056203 Original CRISPR AGAGCTTCTAGTGTGCTCCT GGG (reversed) Intergenic
No off target data available for this crispr