ID: 1078056204

View in Genome Browser
Species Human (GRCh38)
Location 11:8010895-8010917
Sequence GAGAGCTTCTAGTGTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078056204_1078056206 17 Left 1078056204 11:8010895-8010917 CCAGGAGCACACTAGAAGCTCTC No data
Right 1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG No data
1078056204_1078056207 18 Left 1078056204 11:8010895-8010917 CCAGGAGCACACTAGAAGCTCTC No data
Right 1078056207 11:8010936-8010958 GTTCTCTGCTGCAGAAGGCAGGG No data
1078056204_1078056205 13 Left 1078056204 11:8010895-8010917 CCAGGAGCACACTAGAAGCTCTC No data
Right 1078056205 11:8010931-8010953 GAGTAGTTCTCTGCTGCAGAAGG 0: 2
1: 0
2: 8
3: 227
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078056204 Original CRISPR GAGAGCTTCTAGTGTGCTCC TGG (reversed) Intergenic
No off target data available for this crispr