ID: 1078056206

View in Genome Browser
Species Human (GRCh38)
Location 11:8010935-8010957
Sequence AGTTCTCTGCTGCAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078056203_1078056206 18 Left 1078056203 11:8010894-8010916 CCCAGGAGCACACTAGAAGCTCT No data
Right 1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG No data
1078056204_1078056206 17 Left 1078056204 11:8010895-8010917 CCAGGAGCACACTAGAAGCTCTC No data
Right 1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078056206 Original CRISPR AGTTCTCTGCTGCAGAAGGC AGG Intergenic
No off target data available for this crispr