ID: 1078057115

View in Genome Browser
Species Human (GRCh38)
Location 11:8018052-8018074
Sequence GCATCCAGCCCACAATCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078057115_1078057119 17 Left 1078057115 11:8018052-8018074 CCCTGTGATTGTGGGCTGGATGC No data
Right 1078057119 11:8018092-8018114 TTGCAACCTCTGTAACCCATAGG No data
1078057115_1078057120 18 Left 1078057115 11:8018052-8018074 CCCTGTGATTGTGGGCTGGATGC No data
Right 1078057120 11:8018093-8018115 TGCAACCTCTGTAACCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078057115 Original CRISPR GCATCCAGCCCACAATCACA GGG (reversed) Intergenic
No off target data available for this crispr