ID: 1078057369

View in Genome Browser
Species Human (GRCh38)
Location 11:8019148-8019170
Sequence GTCCCCGCCATTGGCAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078057365_1078057369 -9 Left 1078057365 11:8019134-8019156 CCCCGCAGTCGCGCGTCCCCGCC No data
Right 1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG No data
1078057366_1078057369 -10 Left 1078057366 11:8019135-8019157 CCCGCAGTCGCGCGTCCCCGCCA No data
Right 1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG No data
1078057364_1078057369 -3 Left 1078057364 11:8019128-8019150 CCGGGTCCCCGCAGTCGCGCGTC No data
Right 1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG No data
1078057363_1078057369 -2 Left 1078057363 11:8019127-8019149 CCCGGGTCCCCGCAGTCGCGCGT No data
Right 1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG No data
1078057356_1078057369 27 Left 1078057356 11:8019098-8019120 CCCGAGCGAGGGGGAGGGGGCCT No data
Right 1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG No data
1078057362_1078057369 7 Left 1078057362 11:8019118-8019140 CCTCACGGGCCCGGGTCCCCGCA No data
Right 1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG No data
1078057357_1078057369 26 Left 1078057357 11:8019099-8019121 CCGAGCGAGGGGGAGGGGGCCTC No data
Right 1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078057369 Original CRISPR GTCCCCGCCATTGGCAGAGC CGG Intergenic
No off target data available for this crispr