ID: 1078059426

View in Genome Browser
Species Human (GRCh38)
Location 11:8033656-8033678
Sequence CCGTGCCAGGCCCTGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 473}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078059426_1078059435 -1 Left 1078059426 11:8033656-8033678 CCCCAACCCAGGGCCTGGCACGG 0: 1
1: 0
2: 6
3: 50
4: 473
Right 1078059435 11:8033678-8033700 GCAGAGATGGCAGAGGTGTTTGG 0: 1
1: 0
2: 1
3: 40
4: 398
1078059426_1078059436 2 Left 1078059426 11:8033656-8033678 CCCCAACCCAGGGCCTGGCACGG 0: 1
1: 0
2: 6
3: 50
4: 473
Right 1078059436 11:8033681-8033703 GAGATGGCAGAGGTGTTTGGTGG 0: 1
1: 0
2: 2
3: 38
4: 386
1078059426_1078059434 -8 Left 1078059426 11:8033656-8033678 CCCCAACCCAGGGCCTGGCACGG 0: 1
1: 0
2: 6
3: 50
4: 473
Right 1078059434 11:8033671-8033693 TGGCACGGCAGAGATGGCAGAGG 0: 1
1: 0
2: 3
3: 33
4: 284
1078059426_1078059437 3 Left 1078059426 11:8033656-8033678 CCCCAACCCAGGGCCTGGCACGG 0: 1
1: 0
2: 6
3: 50
4: 473
Right 1078059437 11:8033682-8033704 AGATGGCAGAGGTGTTTGGTGGG 0: 1
1: 0
2: 4
3: 22
4: 253
1078059426_1078059438 4 Left 1078059426 11:8033656-8033678 CCCCAACCCAGGGCCTGGCACGG 0: 1
1: 0
2: 6
3: 50
4: 473
Right 1078059438 11:8033683-8033705 GATGGCAGAGGTGTTTGGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078059426 Original CRISPR CCGTGCCAGGCCCTGGGTTG GGG (reversed) Intronic
900120123 1:1045296-1045318 CCGCACCAGGCCCGGGGTCGGGG - Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
900633485 1:3651024-3651046 CCCCGCCTGGCCCTGGGTTCTGG + Intronic
900697864 1:4023340-4023362 CCATGCCAGCCCCTGGGTCACGG - Intergenic
901378216 1:8854863-8854885 CCGTGCCTGGCCCTAGTTTCTGG - Intergenic
901639945 1:10688074-10688096 CCGTACCAGGCCCGGGGAGGAGG + Intronic
901642315 1:10698998-10699020 CCAGGCCAGGCCATGGGTGGGGG - Intronic
901739220 1:11331188-11331210 CTGTGCCAGGCTCTGTGTCGAGG + Intergenic
902195673 1:14796234-14796256 CCATGCCCAGCCCTGGATTGAGG - Intronic
902837962 1:19058809-19058831 CTGTGCCAGGCACGGGGATGTGG - Intergenic
903188396 1:21642344-21642366 CTGTGCCAGGCCCTGGTTTCAGG + Intronic
903330132 1:22593036-22593058 CCATGCCGGGCCCTGGGCTGGGG + Intronic
903540690 1:24094626-24094648 GGGTGCCAGGCCCTGGGTTAGGG - Intronic
903668553 1:25022372-25022394 CCCTGTGAGGCCCTGGGGTGGGG + Intergenic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
903907255 1:26696051-26696073 CGGGGCCAGGCCCTGGGGAGCGG + Exonic
904038695 1:27572062-27572084 CCCTGTCAGGCCTTGAGTTGGGG - Intronic
904310389 1:29625552-29625574 ACATGTCAGGCCCTGGGTTAAGG + Intergenic
904402387 1:30265381-30265403 CCGTGGCAGGCCCTGAGGAGTGG - Intergenic
904447948 1:30589701-30589723 ACGTGCCTGGCCCTGTGCTGTGG - Intergenic
905242144 1:36588262-36588284 GTGTGCCAGGCCCTGAGCTGGGG - Intergenic
905284951 1:36873185-36873207 GAGTGCCAGGCCCTGTGCTGGGG - Intronic
905298774 1:36971961-36971983 TGGTGCCAGGCCCTGGGGAGTGG - Intronic
905460454 1:38119316-38119338 ACGGGCCAGGCCCTGGGCTAGGG - Intergenic
905485515 1:38293019-38293041 CCAAGCCAGGCCCTGGGCTGGGG - Intergenic
905886490 1:41494718-41494740 CTGTGTCAGGCCCAGGGCTGGGG + Intergenic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
906704727 1:47886711-47886733 CACTGCCAGGCCCTGTGTTAGGG + Intronic
906730841 1:48079837-48079859 CCGTTCCAGGCCCTGTGCTAGGG + Intergenic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907392789 1:54169142-54169164 CCGTGCCAGGTGCTGTGTTTGGG + Intronic
907496703 1:54850139-54850161 CCTTTCCAAGCCCCGGGTTGTGG + Exonic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
912381353 1:109249746-109249768 CCTTGCCGGGCCCCGGGTTCCGG - Intergenic
912511886 1:110195325-110195347 ACGGGCCAGGCCCTGTGCTGGGG + Intronic
912953301 1:114135443-114135465 CTGTGCCAGGCATGGGGTTGAGG - Intronic
915443543 1:155961748-155961770 CCTTGCCAGGCACTGGGGTTTGG + Exonic
915851758 1:159331768-159331790 CCATGACAGGCCCTGGTGTGTGG + Intergenic
916045870 1:160999580-160999602 CCATGCCAGGCCCTGGGATGGGG + Intronic
916280870 1:163049642-163049664 CTGTGCTAGGGCCTGGGTCGGGG + Intergenic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
918048735 1:180956366-180956388 CAGTGCCAGGCACTGGGGAGGGG + Intergenic
918134349 1:181658487-181658509 CCATGCCAGACCCTGGGCTAGGG - Intronic
918438948 1:184546469-184546491 CTGTGCCAGACCCTGTGTTAGGG + Intronic
919078446 1:192840319-192840341 CTGTGTCAGGCACTGGGTTAAGG - Intergenic
919814014 1:201426471-201426493 CCTTGTAAGGCCGTGGGTTGTGG + Intronic
919922994 1:202177404-202177426 CCCTGCAGGGCCCTGGGGTGTGG - Intergenic
922766733 1:228160002-228160024 CCCTGCCAGTCCCTGGGGAGGGG - Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923351999 1:233117339-233117361 CCGCGCCAGGCCGGGGGTTGTGG - Intronic
923678601 1:236101001-236101023 CCTTGCCGGGCCCAGGGCTGTGG - Intergenic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
924720206 1:246615586-246615608 CCGTGCCCGGCCCAGAGATGGGG - Intronic
1062949527 10:1487504-1487526 CTGCTCCCGGCCCTGGGTTGTGG + Intronic
1064328386 10:14372129-14372151 CTGTACCAGGCCCTGGGTCATGG - Intronic
1065368028 10:24953267-24953289 CAGCTCCAGGCCCTGGGATGAGG - Intergenic
1065996448 10:31063844-31063866 CCATGCCTGGCCGTGGGATGGGG + Intergenic
1067053360 10:43037764-43037786 CCCTGCCAGGCACGAGGTTGGGG - Intergenic
1067221340 10:44346385-44346407 GTGTGCCTGGCCCTGGGCTGAGG - Intergenic
1067234669 10:44437589-44437611 ACCAGCCAGGCCCTGGGTTTAGG - Intergenic
1069588912 10:69630143-69630165 ACCTGCCCGGCCCAGGGTTGGGG - Intergenic
1069642964 10:69968150-69968172 CCGGGAAAGGCCCTGGGTTTTGG - Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1070129863 10:73648431-73648453 CCGTGCCAGTTCCTGGGTGCTGG + Exonic
1070154809 10:73826855-73826877 CCATGCCTAGCCCTGGGTTTGGG - Intronic
1070592465 10:77810768-77810790 CCCGGCCAGGCCCTGGGCTCTGG - Intronic
1070749267 10:78954384-78954406 CTGTGCCAGGCCCTGGGAGCAGG + Intergenic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1073176604 10:101560919-101560941 CCTTGCCAAGGCCTGGGTGGGGG - Intergenic
1074070763 10:110066521-110066543 CCGTGCCTGGCCCTTGATTAGGG + Intronic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074987849 10:118673166-118673188 CTGTGCCAGGCCATGTGTTATGG + Intergenic
1075688450 10:124379743-124379765 CCGTGCAAGGCTCTGGGAAGTGG - Intergenic
1076344449 10:129770858-129770880 CAGTCCAAGGCCCTGGGGTGGGG + Intergenic
1076630149 10:131847457-131847479 GCGTGGCAGGCCCTGCGCTGTGG - Intergenic
1076738168 10:132467964-132467986 CCGTGGCTGGCCCTGGGAGGGGG - Intergenic
1076835994 10:133021211-133021233 CCGGCCCCAGCCCTGGGTTGAGG + Intergenic
1077042638 11:531346-531368 CCCTCCCAGGGCCCGGGTTGAGG - Intergenic
1077151141 11:1073640-1073662 TCGTCCCAGGCCCTGGGTCTGGG + Intergenic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077229561 11:1452607-1452629 CTGTGCCGGGCCCTTGGGTGGGG - Intronic
1077229599 11:1452742-1452764 CTGTGCCGGGCCCTTGGGTGGGG - Intronic
1077368950 11:2172686-2172708 CCCCACCAGGCCCCGGGTTGAGG + Intergenic
1077437487 11:2549812-2549834 CCATGACTGGCCCTGGGTGGCGG + Intronic
1077490111 11:2857189-2857211 CCTTCCCTGGCCCTGGGATGAGG + Intergenic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078102138 11:8336268-8336290 CCGTGCCAGGCACCAGGCTGTGG + Intergenic
1078518882 11:12047656-12047678 CAGTGCCTGGCCCTGGGCAGGGG - Intergenic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1079342003 11:19618919-19618941 CCATGACAGGCCCTGGTGTGTGG + Intronic
1080580772 11:33641956-33641978 CTGTACTAGACCCTGGGTTGGGG - Intronic
1080720596 11:34844629-34844651 CCGGGCCAGAGCCTAGGTTGGGG + Intergenic
1080989385 11:37511895-37511917 CCCAGCCAGGCCCAGTGTTGAGG + Intergenic
1081538758 11:44014927-44014949 CCGCCACTGGCCCTGGGTTGAGG - Intergenic
1081812480 11:45921883-45921905 GCGTGCCAGGCCCTGTGCTAAGG - Intronic
1081861134 11:46333881-46333903 CTGTGCCAGGCACAGGCTTGTGG + Intronic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1082006275 11:47420853-47420875 ATGTGCCAGTCCCTGGGCTGGGG - Intronic
1082089780 11:48079829-48079851 CCGTGCCTGCTTCTGGGTTGGGG + Intronic
1083333957 11:61912234-61912256 GGGAGCCAGGCCCTGGGTCGGGG - Intronic
1083419637 11:62545813-62545835 CCGGGCCAGGCTCTGGGGCGGGG + Intronic
1083581216 11:63826793-63826815 TCATGCCAGGCACTGGGCTGTGG + Intronic
1083817981 11:65148120-65148142 CTGTGGCAGGCCCTGGGTCTGGG - Intergenic
1083946206 11:65924552-65924574 CTGAGTCAGGCCCTGGGTGGTGG - Intergenic
1083983134 11:66190935-66190957 AAGGGCCAGGCCCTGGGATGAGG + Intronic
1084433080 11:69122342-69122364 GTGTGCCAGGCACTGGGTAGGGG - Intergenic
1084566373 11:69931152-69931174 CCGTGCAGGGGCCAGGGTTGGGG - Intergenic
1084600071 11:70140028-70140050 CCGTGCCAGGCCCCGGGCTAAGG + Intronic
1084615604 11:70233863-70233885 CCGTGCCAGGCCCTGGGGAGAGG - Intergenic
1085046959 11:73359306-73359328 GCGTCCCAAGCCTTGGGTTGAGG + Intronic
1085283998 11:75348352-75348374 CCCTGCCTGGGCCTGGGTTGGGG + Intronic
1085411911 11:76296469-76296491 CTGTGCCCGGCCCAGTGTTGGGG + Intergenic
1085450404 11:76628802-76628824 GTGTGTCAGGCCCTGGGCTGAGG + Intergenic
1086070820 11:82797158-82797180 CCATGGCTGGCCCTGGGTTCTGG + Intergenic
1087651738 11:100875710-100875732 CCGTCACAGGGCCTGGGGTGTGG + Intronic
1088595466 11:111437397-111437419 TCCTGCCAGGAACTGGGTTGGGG + Intronic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089792043 11:120952602-120952624 CCATGCCACTCCCTGGGGTGAGG - Intronic
1089918813 11:122187278-122187300 CTGTGCCAGACCCTGGATTAGGG + Intergenic
1089993386 11:122882776-122882798 CCGTGCCAGGGCCGGGGGTGCGG + Exonic
1090359370 11:126161797-126161819 CCATGACAGGCCCTGGTGTGTGG + Intergenic
1090875078 11:130781674-130781696 TAGTTCCATGCCCTGGGTTGGGG + Intergenic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092172825 12:6384248-6384270 CCGTCCCAGGCTCTGGGCTCGGG + Exonic
1094597020 12:31874933-31874955 TCTTTCCAGGCCCTGGGCTGAGG - Intergenic
1097361208 12:58660322-58660344 CCCTGACAGGCCCTGGTGTGTGG + Intronic
1098156951 12:67609109-67609131 CCCTACCAGGCCCTGGTTTCTGG - Intergenic
1098297283 12:69016966-69016988 CCGTGCCTGGCCCTGTTTTCTGG - Intergenic
1100797676 12:98199323-98199345 CCCTGGCAGGCCCTGGTGTGTGG + Intergenic
1100888043 12:99094128-99094150 ATGTGCCAGGCACTGGGCTGTGG + Intronic
1101845228 12:108358177-108358199 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1101867157 12:108528670-108528692 CCGTGCCTGGCCCCGGGTGTGGG + Intronic
1102024189 12:109704107-109704129 CTGTGCCTGGCCCTGGGGAGTGG - Intergenic
1103137410 12:118519491-118519513 ATGTGCCAGGCACTGGGTAGGGG - Intergenic
1103470486 12:121176460-121176482 CCGTGCCCGGCCCAGCCTTGTGG - Intronic
1103837071 12:123830125-123830147 CCGTGCCAGGCAGTGGACTGGGG - Intronic
1103851972 12:123939204-123939226 CCTAGGCAGGCCCTGGGTGGTGG - Intronic
1103896567 12:124277490-124277512 GTGTGGCAGGTCCTGGGTTGTGG - Intronic
1105000366 12:132686899-132686921 CCGGGCCAGGCCCTGCGGGGTGG - Intronic
1105213442 13:18271239-18271261 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1105607033 13:21934475-21934497 CCGTGCCAGGCCCTGAGGCAAGG - Intergenic
1105746718 13:23383897-23383919 CTGTGCCAGGCACTGGGGTTGGG - Intronic
1107834435 13:44402182-44402204 CTGTGCCAGGCCCTGTTTTAAGG + Intergenic
1110231649 13:73173435-73173457 CTGTGCTAGGCCCTGGGGAGAGG - Intergenic
1110380805 13:74848392-74848414 CTGAGCCAGCCTCTGGGTTGGGG - Intergenic
1111239069 13:85451233-85451255 CCATGCCTGGCCCGAGGTTGGGG - Intergenic
1113585307 13:111460492-111460514 CCCTGCCTGGCCCTGAGCTGCGG - Intergenic
1114618422 14:24080950-24080972 CAGTGCCAGGCACTGGGGGGTGG - Exonic
1116654022 14:47628384-47628406 CTGTGCCAGGCCTTGAGTTTAGG - Intronic
1117335980 14:54757787-54757809 CCCAACCAGCCCCTGGGTTGTGG - Intronic
1118329848 14:64806693-64806715 AGGTGCCAGGCCCTGGGTGGTGG + Intronic
1118349063 14:64960633-64960655 GCGTGCCAGACCCTGTGTTATGG - Intronic
1118736687 14:68706051-68706073 CAGAGCCAGGCCCTGGCTGGAGG + Intronic
1119331335 14:73796262-73796284 CCATACCAGGACCTGGGATGTGG - Intergenic
1119442826 14:74640086-74640108 TCTTGCCAGGCACTGGGTTACGG - Intergenic
1121059400 14:90891182-90891204 CTGTGCCAGGCCCTGGGGTAGGG - Intronic
1121135525 14:91494570-91494592 CCGTGCCTGGCCCTTATTTGTGG - Intronic
1122204596 14:100142285-100142307 GCCTGCCTGGCCCTGGGCTGGGG + Intronic
1122233429 14:100318649-100318671 CCGGGCCAGACCCTAGGCTGAGG + Intergenic
1122234626 14:100324693-100324715 CTGTGCCTGGCCCTGGGTCATGG + Intronic
1122485604 14:102077554-102077576 CCGTGCCTAGCCCTTGGTTGGGG + Intergenic
1122769357 14:104091153-104091175 CTGCGCCCGGCCCTGGGATGCGG + Intronic
1122846168 14:104500361-104500383 CCGTGCCAGGCACTGGCTCTCGG - Intronic
1122898539 14:104772492-104772514 CCTGCCCAGGCCCTGGGTTCAGG + Intronic
1122967967 14:105140060-105140082 CCCTGCCAGGCCCTTGCCTGGGG + Intergenic
1124097550 15:26662625-26662647 GCGTGCAAGGACCAGGGTTGTGG - Intronic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124636448 15:31367759-31367781 ACGTGCCAGGCGCTGTGCTGAGG + Intronic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1125449174 15:39790540-39790562 CCGTGCCCGGCCCTCGCTAGAGG - Intergenic
1125725648 15:41866924-41866946 CAGTGGAAGGCCCTGGGCTGGGG + Intronic
1126070334 15:44860370-44860392 ATGTGCCAGGCACTGGGCTGAGG - Intergenic
1126087701 15:45024747-45024769 ATGTGCCAGGCACTGGGCTGAGG + Intronic
1126706267 15:51408692-51408714 CCATGACAGGCCCTGGTGTGTGG + Intergenic
1126775706 15:52098983-52099005 CCGCGCCAGGCCCCGGCTTTGGG - Intergenic
1127499810 15:59545263-59545285 CCGTGCCCGGCCTTCAGTTGAGG - Intergenic
1127539639 15:59924225-59924247 CTGTGCCAAGCCCCGGGTTAAGG + Intergenic
1128218035 15:65947684-65947706 CAGACCCAGGCCCTGGGTTCTGG + Intronic
1128440883 15:67707548-67707570 CTGTGCCAGGCCCTGGAGAGTGG + Intronic
1128801440 15:70499598-70499620 GCATGCCAGGCCCTGGGCTAAGG + Intergenic
1128982616 15:72198019-72198041 CCGCGCCAGGCCCTGGCCTCCGG - Intergenic
1129382672 15:75177978-75178000 GTGAGCCAGGCCCTGGCTTGGGG + Intergenic
1129975147 15:79815695-79815717 GCGTGCCAGGCCCTGGCTGAGGG + Intergenic
1130151413 15:81314592-81314614 CCGTGCTTGGCCCTGGGGAGTGG - Intronic
1130210119 15:81914852-81914874 CCGTGCCAGTTCCTGGCTGGGGG - Intergenic
1130680796 15:85994660-85994682 CCCTGACAGGCCCTGGTGTGTGG + Intergenic
1130980595 15:88809508-88809530 ATGTGCCTGGCCCTGGGTTAGGG - Intronic
1131155220 15:90070970-90070992 CTGTGCCAGGCCCTGGACTTGGG - Intronic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132594301 16:741188-741210 GCGCCCCAGGCCCCGGGTTGGGG + Intronic
1132698662 16:1212989-1213011 CCGAGGCAGGTCCTGGGGTGTGG + Intronic
1132826638 16:1908533-1908555 CCCCCCCAGGCCCTGGGTTCAGG + Intergenic
1133125301 16:3642344-3642366 TCCTGCCAGGCCATGGGATGTGG + Intronic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1133955604 16:10440912-10440934 CCCTGACAGGCCCTGGTGTGTGG + Intronic
1134017380 16:10898592-10898614 GTGTGCCAGGCCTTGGGCTGGGG - Intronic
1134076171 16:11292998-11293020 CCGTGCCAAGCCTGGGGGTGGGG + Intronic
1138203524 16:55107535-55107557 AAGTGCCAGGCCCTGAGATGTGG + Intergenic
1138477959 16:57283364-57283386 TGGTGCCAGACCCTGGGCTGAGG - Intronic
1138657092 16:58497824-58497846 CCCTGCCAGGACCTGGGCAGGGG + Intronic
1139373834 16:66484604-66484626 CAGGGCCAGACCCTGGGATGAGG + Intronic
1139503967 16:67389903-67389925 CCATGCCTGGGGCTGGGTTGGGG + Exonic
1139572622 16:67822726-67822748 AAGTGCAAGGCCCTGGGCTGGGG + Intronic
1140734756 16:77888341-77888363 CCATGCCAGGCACTGGGGTCTGG - Intronic
1141537388 16:84691884-84691906 CCGTGCCAACACCTGGGTTTTGG + Intergenic
1141646510 16:85370699-85370721 CAGTGTCCAGCCCTGGGTTGGGG - Intergenic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG + Intergenic
1142211301 16:88809896-88809918 CCAGGCCAGCCCCTGGGTTGGGG + Intronic
1142242107 16:88952278-88952300 CTGTGCCAGGCCACGGGGTGAGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142596913 17:1034294-1034316 GCGTGCCCGACCCTGGGGTGGGG + Intronic
1142598444 17:1040714-1040736 CCATGCCAGGCCCCGGGTCCAGG + Intronic
1142622431 17:1173397-1173419 CCCTGCCAGGCCCTTGGTGGTGG - Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1143312676 17:6005766-6005788 CCCTGACAGGCCCTGGTATGTGG - Intronic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144781660 17:17811492-17811514 CCGGGCCAGGCTTTAGGTTGGGG + Intronic
1144858469 17:18284300-18284322 CCGTGCCTGACCCTTGTTTGGGG + Intronic
1144974735 17:19133139-19133161 GCTGGCCCGGCCCTGGGTTGTGG + Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1146277567 17:31525021-31525043 CCGTGCCACAGCCTGGGTTGGGG + Intronic
1146722421 17:35132635-35132657 GAGGGCCAGGCCCTGGGTGGAGG - Intronic
1146955445 17:36934419-36934441 AGGTGACAGGCCCTGGGTTGGGG + Intergenic
1147248730 17:39139700-39139722 CTGAGCCAGGACCTGGGTGGGGG - Exonic
1147315347 17:39617773-39617795 CCGTGCCAGGCGCGGGGCGGGGG - Intergenic
1147531400 17:41281586-41281608 CCATGACAGGCCCTGGGGTGTGG - Intergenic
1148155729 17:45424483-45424505 CAGTGCCAGGCCCTGGGGAATGG - Intronic
1148186840 17:45650543-45650565 CTGTGCCAGGCGCTGGGGAGGGG + Intergenic
1148552914 17:48561241-48561263 CCCTGCCAGGCACTGGGCTAAGG - Intronic
1149447607 17:56725711-56725733 CTGTGCCTGGCCCTGTGTTAAGG + Intergenic
1150310528 17:64125449-64125471 CTGTGCCCAGCCGTGGGTTGGGG - Intronic
1150387419 17:64773147-64773169 CAGTGCCAGGCCCTGGGGAATGG - Intergenic
1151347579 17:73511582-73511604 GGGTACCAGGCCCTGGGCTGGGG + Intronic
1151681160 17:75623686-75623708 CCCTGCTAGGCCATGGGCTGGGG - Intergenic
1152695433 17:81741597-81741619 CCCAGCCTGGCCCTGGCTTGTGG - Intergenic
1153345414 18:4020425-4020447 ATGTGCCAGGTCCTGGGCTGGGG + Intronic
1157334032 18:46724241-46724263 CCCAGCCAGACCCTGGGCTGAGG + Intronic
1157584410 18:48791953-48791975 ACGTGCCAGGCCCTGGGCTATGG + Intronic
1157847783 18:51019504-51019526 CCCTCCCAGGCCCTGGCTTCAGG + Intronic
1158414112 18:57234248-57234270 CTGTGCTAGGACCTGGGGTGGGG + Intergenic
1158552882 18:58451698-58451720 TCGTGCCTGGCCTTGTGTTGGGG - Intergenic
1160448214 18:78943417-78943439 CCCTGAGAGGCCCTTGGTTGTGG - Intergenic
1160723438 19:607432-607454 CTGTGCCAGGCTCTGGGGAGGGG - Intronic
1160773931 19:846228-846250 CAGTGCCTGGCCATGGGCTGGGG + Exonic
1160775914 19:855645-855667 CAGTGCCTGGCCATGGGCTGGGG + Exonic
1160929975 19:1566074-1566096 CCGTTCTAGGCCCTGGGTATGGG + Intronic
1160941865 19:1623885-1623907 CAGTGCCAGGCCCTGTGTCCTGG - Intronic
1161171297 19:2813691-2813713 CCACACCAGGCCCTGGATTGGGG + Exonic
1161588698 19:5118931-5118953 CCCTGGCAGGCCCTGGGGTGTGG + Intronic
1162110683 19:8398082-8398104 CCGCCCCAGGCTCTGGGGTGGGG - Intronic
1162160206 19:8708219-8708241 CCATGACAGGCCCTGGTGTGTGG + Intergenic
1162781128 19:13007504-13007526 CCATGCCAGGGCCTGGGCTTGGG - Intronic
1163738160 19:18994518-18994540 GCATGCCAGGCCCTGGGCTCAGG - Intronic
1163748482 19:19061725-19061747 ACCTGCCAGGCCCTGGGAGGGGG - Intergenic
1164760596 19:30725698-30725720 AGGTGCCAGGCGCTGTGTTGAGG - Intergenic
1165648872 19:37468794-37468816 CCGTGCCAGGCTGAGGGTAGCGG + Intronic
1165761929 19:38326689-38326711 CAGTGACAGGCGCTGGGCTGAGG - Exonic
1165834562 19:38746213-38746235 CCATGCCCGGCCCTGTTTTGGGG - Intronic
1165958320 19:39515589-39515611 CCCTGCCAGGAGCTGGGCTGGGG - Exonic
1166194682 19:41198003-41198025 CCATTCCAGGACCTGGGTTGGGG - Intronic
1166345496 19:42162775-42162797 CTGTCCCAAGCCCTGGCTTGGGG - Intronic
1166752747 19:45172482-45172504 CTGTGCCAGGCCCAGGGGTGTGG + Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
1167071705 19:47226066-47226088 CCGTGCCAGGGGCTGGGGGGCGG + Intronic
1167612071 19:50512493-50512515 CAGTGCAAGGCCCAGGGCTGTGG + Exonic
1167694841 19:51009328-51009350 CCCAGCCATGCCCTGGGGTGGGG + Exonic
924968557 2:101200-101222 CCCTGGCAGGCCCGGGGGTGCGG + Intergenic
925394730 2:3525143-3525165 CCCGGCCAGGCCCAGGGTAGTGG - Intergenic
925443711 2:3909813-3909835 CTGTGCCAGGCCTTGTGATGGGG + Intergenic
925595758 2:5553920-5553942 TCTTGCCATGCCCTGGGCTGAGG - Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
927460474 2:23294284-23294306 TCGTGCCAGGTCCTGGGTGGTGG - Intergenic
927694172 2:25229267-25229289 CCTTACCAGGCCCTGTGCTGGGG - Exonic
927751195 2:25672801-25672823 CTGTGCCAGGCCTTGGGATTAGG - Intronic
929428197 2:41865090-41865112 CAATGCCAGCCCCTGGGTTGTGG - Intergenic
930123425 2:47778296-47778318 GCGTGCCAAGCACTGGGCTGAGG + Intronic
930154762 2:48094670-48094692 CAGTGCAAGGCTCTTGGTTGGGG - Intergenic
931670455 2:64642703-64642725 CCTCGACAGACCCTGGGTTGGGG + Intronic
932161792 2:69466829-69466851 CCGTGCCTGGCCCTGTGTGTAGG - Intronic
933765682 2:85707018-85707040 CCCCACCAGGCCCTGGGTCGGGG + Intergenic
934300882 2:91775505-91775527 CAGTGCCAGGCTCTAGGCTGAGG + Intergenic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
934657724 2:96124692-96124714 CCGTGCCAGGAGGTAGGTTGGGG + Intronic
934780925 2:96969166-96969188 CCATGCCAGGCTCTGGATAGTGG - Intronic
936717836 2:115210181-115210203 CCATGACAGGCCCTGGTGTGTGG + Intronic
937127179 2:119482221-119482243 CCGGGCCAGGGCCTGGGTTAGGG + Intronic
937132384 2:119523456-119523478 CCTTGCCAGGACCTGGCTTTGGG + Intronic
937854158 2:126660603-126660625 CTGTGACAGGCCCTGAGTGGGGG - Intronic
938277349 2:130038048-130038070 GGGTGCCAGGCCCAGGGCTGTGG - Intergenic
938328322 2:130428851-130428873 GGGTGCCAGGCCCAGGGCTGTGG - Intergenic
938361625 2:130692643-130692665 GGGTGCCAGGCCCAGGGCTGTGG + Intergenic
938438035 2:131299332-131299354 GGGTGCCAGGCCCAGGGCTGTGG + Intronic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
946298032 2:218801933-218801955 ACTTGCCAGGCCCTGGGCTTTGG + Intronic
946458374 2:219848286-219848308 CTGTGCCAGGCCCTCGCTCGAGG + Intergenic
947573106 2:231250706-231250728 CCTTGCGGGGGCCTGGGTTGAGG + Intronic
948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG + Intergenic
948438843 2:237972482-237972504 GGGTGCCAGGTCCTGGGATGTGG - Intronic
948465143 2:238148625-238148647 GGGTACCAGGCCCGGGGTTGGGG + Intronic
948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG + Intronic
948864201 2:240767215-240767237 CCTGGCCAGGCCCTGGGATCTGG - Intronic
948929487 2:241122872-241122894 CAGAGCCAGACCCTGGTTTGAGG - Exonic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168896535 20:1327586-1327608 CCCTGCCTGGGCCTGGGTTCAGG - Intronic
1168967872 20:1910189-1910211 CTGTGCCAGGCCCTGAGCTAAGG - Intronic
1169375866 20:5066195-5066217 CAAGGCCAGGCCCTGGGATGTGG - Intergenic
1170611178 20:17914986-17915008 CTTTTCCATGCCCTGGGTTGGGG - Intergenic
1170681108 20:18526423-18526445 CCATGCCAGGCCCTTGGGTAGGG - Exonic
1171097236 20:22343683-22343705 CCATGCCAGTCCCTAGGTTCCGG - Intergenic
1171882022 20:30624656-30624678 CCCTGACAGGCCCTGGTGTGTGG - Intergenic
1172277081 20:33685829-33685851 CCGGGCCCCGCCCTGGGGTGCGG - Intronic
1172613152 20:36266505-36266527 CTGTGTCAGGCCCAGGGCTGAGG - Intronic
1172634687 20:36402005-36402027 CAGTGGCAGGGCCAGGGTTGGGG + Intronic
1172654012 20:36525873-36525895 CCCTGCCAGGTCCTGGGCTGTGG - Exonic
1172699632 20:36845290-36845312 CTGTGTCAGGCCCTGGCATGGGG - Intronic
1172994981 20:39064136-39064158 CCATGCCTGGCCCTGTGCTGTGG + Intergenic
1173658834 20:44719211-44719233 GCATGCCAGGCCCTGTGCTGAGG + Intronic
1174169876 20:48609604-48609626 GCCTGCCAGGCCCTGGCCTGGGG + Intergenic
1174749744 20:53100019-53100041 CAGTGCCAGGGGCTGGGCTGAGG + Intronic
1175074364 20:56360427-56360449 CAGTGCCAGGGCCTGAGCTGGGG - Intronic
1175228326 20:57458352-57458374 CCTTGTCAGGCCCTGGGCAGTGG - Intergenic
1175360048 20:58402600-58402622 CTGTGCTAGGCACTGGGATGTGG - Intronic
1176125001 20:63471414-63471436 CCCTTCCAGGCCCAGGGCTGGGG + Intronic
1176132620 20:63502728-63502750 CCGTGGCTGGCCCTGGTCTGTGG - Intergenic
1176304559 21:5116396-5116418 TGGTGCCAGGCCGTGGGTTCAGG - Exonic
1177228973 21:18294355-18294377 AGGGGCCTGGCCCTGGGTTGTGG - Exonic
1178533926 21:33397230-33397252 GCTTCCCAGGCCCTGGGCTGTGG + Intergenic
1179553903 21:42160412-42160434 CCGTGGCAGGGGCTGGGTAGGGG + Intergenic
1179852497 21:44145634-44145656 TGGTGCCAGGCCGTGGGTTCAGG + Exonic
1179966605 21:44810466-44810488 CCGTGGGAGGCACAGGGTTGTGG - Intronic
1180261706 21:46674787-46674809 CCCTGGCAGGCCCAGGGGTGCGG - Intergenic
1180816274 22:18791639-18791661 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1181030767 22:20148036-20148058 CCGGACAGGGCCCTGGGTTGGGG + Intergenic
1181202463 22:21225971-21225993 CAGTGCCAGGCTCTAGGCTGGGG - Intronic
1181271017 22:21658408-21658430 CCGTGCTGGGCCCTGGGCGGGGG + Intronic
1181310621 22:21942745-21942767 CCAGGCCAGACCCTGGGATGAGG - Intronic
1181361979 22:22344551-22344573 CTGTCCCAGGCCCTGCCTTGGGG + Intergenic
1181512554 22:23395348-23395370 CCGGACAGGGCCCTGGGTTGGGG - Intergenic
1181699244 22:24610643-24610665 CAGTGCCAGGCTCTAGGCTGGGG + Intronic
1182025352 22:27114023-27114045 ATGTGCCAGGCCCTGTGTTAGGG + Intergenic
1182613288 22:31567367-31567389 GCCTGCCAGGCCCTGCGTTCTGG - Intronic
1182804344 22:33057962-33057984 CCGGGCCGGGCGCTGGGTGGAGG + Intronic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183310462 22:37106876-37106898 ACCTGCCAGGCACTGGGTTCTGG + Intronic
1183442766 22:37832596-37832618 TCCTGCCAGGCCCTGGGTCTGGG + Intronic
1183475552 22:38034051-38034073 CCATGCCAAGCCCTAGGTTTTGG - Intronic
1183614773 22:38937266-38937288 CCGTGGGAAGCCCTGGGCTGGGG - Intergenic
1183874878 22:40771398-40771420 CCGTGCCAGGCCCTAGTTTTTGG + Intronic
1183934650 22:41255282-41255304 CGGTGCTAGGCCCTGAGCTGAGG - Intronic
1184118262 22:42434398-42434420 CCCAGGCAGGCCCTGGGCTGTGG + Intergenic
1184130662 22:42514832-42514854 GCCTGGCAGGCCCTGGGGTGGGG - Intronic
1184140841 22:42576662-42576684 GCCTGGCAGGCCCTGGGGTGGGG - Intergenic
1184372585 22:44091994-44092016 ACGTGCCATGCTCTGGGCTGGGG + Intronic
1184409211 22:44317062-44317084 GCGTGCCAGGTCAGGGGTTGGGG - Intergenic
1184609519 22:45593874-45593896 GCCTGCCAGGGCCTGGGTTGGGG + Intronic
1184973527 22:48044866-48044888 TCCTGCCAAGCCCTGGGATGAGG - Intergenic
1185010123 22:48308247-48308269 CTGTGCCAGGCCCTGGGTGAAGG + Intergenic
1185266379 22:49906438-49906460 CCGTGGCCGTGCCTGGGTTGGGG - Intronic
1185344230 22:50304419-50304441 CTGTGTCAGGGCCTGGCTTGAGG + Intronic
1203224450 22_KI270731v1_random:69442-69464 CAGTGCCAGGCTCTAGGCTGGGG + Intergenic
1203266377 22_KI270734v1_random:17350-17372 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
949497339 3:4644926-4644948 CTGTGCCAGGCACTAGGTTTAGG - Intronic
950862198 3:16159033-16159055 CCATGACAGGCCCTGGTGTGTGG + Intergenic
951261727 3:20517543-20517565 CCGTGCCCGGCCCTGACATGAGG + Intergenic
952884529 3:38004167-38004189 GCTTCCCAGGCCCTGGGGTGGGG + Intronic
953141981 3:40237564-40237586 CTGTGTCAGGCTCTGGGTGGTGG - Intronic
954037488 3:47859432-47859454 CTGTGCCAGGCCTTGGGCTGTGG - Intronic
954112811 3:48444868-48444890 CAGTGCCAGGCAAGGGGTTGGGG + Intergenic
954369140 3:50161100-50161122 CGCTGCCAGACCCTGGGCTGGGG - Intronic
954390489 3:50265796-50265818 GTGTGCCAGGCCATGGGTAGGGG - Intergenic
954633869 3:52061095-52061117 GCCTGCCAGGCCCTGGGTAATGG + Intergenic
954645801 3:52130851-52130873 CCATGCTGGGCCCTAGGTTGAGG - Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
954909139 3:54088196-54088218 GCGCGCCAGGCTCAGGGTTGTGG + Intergenic
955348729 3:58179175-58179197 CCATGCCAGGCCCCGGGCTGGGG - Intergenic
955492727 3:59499364-59499386 CCGTGCACGGCACTGGGCTGAGG + Intergenic
957810372 3:85214540-85214562 CCTGGCCAGGACCAGGGTTGGGG - Intronic
957895882 3:86421054-86421076 CCGTCACAGGCCCTGGGACGGGG - Intergenic
961119105 3:124358094-124358116 AAGTGCCAGACCCTGGGCTGGGG - Intronic
961507440 3:127379384-127379406 CTGTACCAGGCTCTGGGTTTGGG - Intergenic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
962606569 3:137037175-137037197 CCGTGCCAGGCCCTGTGGCCAGG + Intergenic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
964422219 3:156515603-156515625 CAGTGCCAGGGCCAGGGTAGTGG - Intronic
965604285 3:170483877-170483899 CCCTGCCAGGCCCTGGTTGCAGG - Intronic
966431937 3:179841117-179841139 CTGTGCCAAGCAATGGGTTGTGG - Intronic
968501149 4:950663-950685 CTGTCCCAGGCCCTGGGTTTGGG - Intronic
968735855 4:2296240-2296262 CCCTGCAAGGCCCTGAGTGGTGG - Intronic
969085353 4:4652343-4652365 ACCTGCCAGGCCTTGGGCTGTGG - Intergenic
969340720 4:6539240-6539262 CTGTGCCACTCCCTGGCTTGTGG - Intronic
969645806 4:8428225-8428247 AAGTGCCAGGCCCGGGGGTGTGG - Intronic
970035617 4:11732277-11732299 CTGTGCCAGGCCCTCGGTTAGGG + Intergenic
975346721 4:73300144-73300166 CCGAGCCAGTCCCTGGGCAGAGG + Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
978934585 4:114359432-114359454 GGGTCCCAGGCCTTGGGTTGTGG - Intergenic
979592771 4:122499191-122499213 ATGTGCCAGGCACTGGGTTAGGG + Intergenic
980083929 4:128372152-128372174 CCATGCCAGGCACTGCGTTATGG - Intergenic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
985325435 4:188763134-188763156 CCTTGACAGGCCCTGGTGTGTGG + Intergenic
985762954 5:1761020-1761042 CCGGGCCAGGCCCCGGGGCGGGG + Intergenic
986536472 5:8793428-8793450 CCTTGCCAGGCCAAGGATTGGGG - Intergenic
986631210 5:9775733-9775755 CCATTCCAGGCCCTGGCTTCTGG - Intergenic
986632380 5:9786186-9786208 GGGTTCCAGGCCCTGAGTTGAGG + Intergenic
988180819 5:27789405-27789427 TCGTGCCAGTCACTGAGTTGTGG + Intergenic
989652340 5:43706950-43706972 CCATGACAGGCCCTGGTGTGTGG - Exonic
992006013 5:72478208-72478230 CTGTGCCAGGCCTTGTGTGGGGG + Intronic
992793904 5:80238492-80238514 CCATGCCTGGCTCTGGATTGGGG - Intronic
996563562 5:124856395-124856417 AAATGCCAGGCCCTGGGTTAAGG - Intergenic
997094556 5:130896225-130896247 CCATGACAGGCCCTGGTGTGTGG - Intergenic
997445548 5:133937161-133937183 CCTTGCCAGTCCCTGAGCTGAGG - Intergenic
997525421 5:134549910-134549932 CCTTGCCAGGTCCTGTGCTGGGG + Intronic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998216431 5:140241398-140241420 AAGTGCCAGGCCCTGTGCTGAGG - Intronic
999109696 5:149108037-149108059 CCATGGCAGGCCCTGGTGTGTGG - Intergenic
999321500 5:150618301-150618323 CTGGGCCAGGGCCTGGGCTGGGG - Exonic
999743751 5:154576376-154576398 GTGTGCCAGGCACTGGGTTAGGG - Intergenic
1000472951 5:161669097-161669119 CAGTGCCAAGACATGGGTTGAGG + Intronic
1001058673 5:168470062-168470084 ACCTACCAGCCCCTGGGTTGGGG - Intronic
1001993537 5:176135622-176135644 CCCTGCCAGGGCCTGGGTGTGGG + Intergenic
1002173965 5:177391098-177391120 CCCTGCCTGGGCCTGGGGTGGGG - Intronic
1002475289 5:179461758-179461780 CCATGCCAGGTGCTGGGATGTGG - Intergenic
1002538921 5:179893491-179893513 CCCTGCCAGGCCCTAACTTGCGG - Intronic
1003269287 6:4593137-4593159 CAGAGCCAGGCCCTGCGGTGGGG - Intergenic
1003914121 6:10769642-10769664 CTGTGCCAGGTCCTGGGCAGAGG + Intronic
1004325924 6:14674006-14674028 CCCTGCCAGGCCTTGGGCAGTGG - Intergenic
1004362772 6:14985894-14985916 CTGTGCCAGACCCTGCGCTGGGG + Intergenic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006639683 6:35483542-35483564 CAGTGCCAGGGCCTGGGATGAGG - Intronic
1006835655 6:36997469-36997491 AGGGCCCAGGCCCTGGGTTGGGG + Intergenic
1007627967 6:43257190-43257212 CTCTGCCAGGCCCTGGGTTCAGG - Intronic
1007636624 6:43303601-43303623 CCTTGAAAGGCCCGGGGTTGGGG + Intronic
1008967089 6:57323605-57323627 CCCTGACAGGCCCTGGTGTGGGG - Intronic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1013033408 6:106358253-106358275 ATGTGCCAGGCCCTGACTTGGGG - Intergenic
1013155452 6:107488972-107488994 CTGTCCCTGTCCCTGGGTTGAGG - Intergenic
1016429060 6:143964089-143964111 CCTTATCAGGCCCTGGGATGGGG - Intronic
1018569127 6:165188261-165188283 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1019167557 6:170108675-170108697 CCGCGCCTGGCCCTGAGCTGAGG + Intergenic
1019538013 7:1538855-1538877 GGCTGCCAGGCCCTGGGGTGGGG + Intronic
1019599126 7:1872716-1872738 CCGTGTCTGGCCCTGTGCTGGGG - Intronic
1020106440 7:5424255-5424277 CCTTGCAAAGCCCTGGATTGCGG - Intronic
1022368321 7:29747039-29747061 CCGTGCCCGGCCCTGGTTAGAGG - Intergenic
1023850528 7:44147608-44147630 GCGGCCCAGGGCCTGGGTTGTGG + Intronic
1024230306 7:47358670-47358692 TCATGCCAGGACCTGGGATGAGG - Intronic
1024231367 7:47366453-47366475 CCGGGCCAGGCACTGGGATAGGG + Intronic
1024428140 7:49253475-49253497 CCGTGCCTGGCCCTGTCTTTAGG + Intergenic
1025040096 7:55634488-55634510 CCGTGACAGGCCCCGGTGTGTGG - Intergenic
1026087179 7:67271918-67271940 CCCTGACAGGCCCTGGTGTGTGG - Intergenic
1026256744 7:68718795-68718817 ATGTGCCAGGCCCTATGTTGAGG - Intergenic
1026689919 7:72542781-72542803 CCCTGACAGGCCCTGGTGTGTGG + Intergenic
1026988410 7:74569258-74569280 GCGTGCCAGACCCTGTGCTGTGG + Intronic
1029104761 7:98166003-98166025 CAGTGCCCGGCCCTGTGCTGGGG + Intronic
1029380441 7:100210964-100210986 CTGTCGCAGGCCCTGGGCTGTGG + Intronic
1029666430 7:101998075-101998097 CTGTGCTAGGTCCTGGGCTGGGG - Intronic
1029712735 7:102308467-102308489 GGGTGCCAGGGCATGGGTTGGGG + Intronic
1030764402 7:113390955-113390977 CTGTGTCAGGCACTGGGTAGAGG + Intergenic
1031076178 7:117214844-117214866 TTGTGCCAGGCATTGGGTTGAGG + Intronic
1031645626 7:124221878-124221900 CCGTGAAAGCCCCTGGGATGGGG + Intergenic
1032403237 7:131638175-131638197 CCTTGCCAGCCCCTGGCTGGGGG + Intergenic
1034441412 7:151087591-151087613 CCGGGCCTGGCGCTGGGCTGAGG + Intronic
1035561153 8:604433-604455 CAATGCCAGGCCCTGGGCCGGGG - Intergenic
1035777884 8:2203481-2203503 TCCTGCCAGGACCTGGGCTGTGG + Intergenic
1038486599 8:27939718-27939740 CAGTGCCAGGCAATGGGCTGGGG + Intronic
1038664912 8:29529661-29529683 AGGTGCCAGGCCCTGGGTGCAGG - Intergenic
1040065296 8:43140296-43140318 CCATGCTAGGCCCTGCCTTGAGG - Intergenic
1040274472 8:46000266-46000288 CCATGACAGGCCCTGGTCTGTGG + Intergenic
1040516114 8:48136464-48136486 CCCTGCCAGGCAGTGGGTTAGGG + Intergenic
1041326002 8:56665094-56665116 CCGCGCCCGGCCCAGGGTGGTGG + Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1042591574 8:70402984-70403006 CCGTGTCAGCCCCGGGGGTGGGG - Intronic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048571902 8:135663519-135663541 AGGTTCCAGGCGCTGGGTTGGGG - Intergenic
1048828684 8:138454908-138454930 ACATGCCAAGCCCTGGGCTGAGG - Intronic
1049061011 8:140276380-140276402 CTGGGCCAGGCCCTGGGGTCAGG + Intronic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049254483 8:141606402-141606424 CAGGGCCAGGCCATGGGCTGGGG + Intergenic
1049553212 8:143270193-143270215 CCGTGCCTGGCCCAGGAATGGGG + Intronic
1049678455 8:143904088-143904110 CCATGCCAGGCCCAGGGAGGAGG + Intergenic
1049746067 8:144263823-144263845 ACGTGCCAGGCCCTGGTAAGTGG - Exonic
1050209090 9:3233264-3233286 CCCTGAGAGACCCTGGGTTGTGG + Intronic
1050566564 9:6890098-6890120 TCATGACAGGCCCTGTGTTGAGG - Intronic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1052170526 9:25390116-25390138 CCATGCCAGGCCCTGTTTTAAGG + Intergenic
1052861355 9:33439767-33439789 CCTTCCCAGGCCCTGGGGGGAGG - Intergenic
1053143666 9:35697653-35697675 CGGGGCCAGGCCCTGGGGTTTGG + Exonic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1053292298 9:36889188-36889210 CCTGGCCAGGGCCTGGCTTGTGG - Intronic
1055083775 9:72293334-72293356 CTGTGTCAGGCACTGGGTTTAGG + Intergenic
1057441851 9:95089162-95089184 CTCTGCCAGGCCCTGGGTGGAGG - Intergenic
1057749605 9:97781174-97781196 CTGCACCAGGTCCTGGGTTGGGG + Intergenic
1057829751 9:98397372-98397394 ACGTGCCAGGCTCTGGGCTAGGG + Intronic
1058434262 9:104947850-104947872 GCGTGCCTGGCCCTGAGCTGAGG + Intergenic
1060191741 9:121598400-121598422 CCGGGCCAGGCCCGGGGTGAGGG - Intronic
1060215632 9:121736796-121736818 CTGTGCCAGGCTCTGGTTCGAGG + Intronic
1060243721 9:121926493-121926515 GGGTGCCAGGCGCTGGGCTGAGG + Intronic
1060781547 9:126416804-126416826 ACCTGCCAGGACCTGGGCTGGGG - Intronic
1061017947 9:127993516-127993538 ATGTGCCAGGCCCTGGGTTGGGG - Intergenic
1061203275 9:129149212-129149234 ATGTGCCAGGCCCTGAGCTGAGG - Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1061917700 9:133763767-133763789 GCGAGCCAGGCTCTGGGTAGTGG - Exonic
1062289940 9:135789947-135789969 CAGTGCCAGGGCCTGGGTTGTGG - Intronic
1062344104 9:136106978-136107000 TCTTACCAGGGCCTGGGTTGGGG - Intergenic
1062438333 9:136556970-136556992 CCCAGCCAGGCCCCAGGTTGAGG + Intergenic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1062685248 9:137809384-137809406 CAGAGCCAGTCCCTGGGATGTGG + Intronic
1062707649 9:137954177-137954199 GGGTGCCAGCCCCTGGCTTGGGG - Intronic
1186479878 X:9888396-9888418 CCGTGCCATGCCATGGCATGAGG - Intronic
1186585290 X:10867018-10867040 CAGTGCTAGGCCTTGGCTTGAGG + Intergenic
1187341367 X:18425037-18425059 CCGTGCCGGGGGCTGGGGTGGGG - Intergenic
1190070042 X:47272171-47272193 GCATACCAGGCCCTGGGCTGGGG + Intergenic
1190289520 X:48983081-48983103 CCGTGTCCGGGCCTGGGATGGGG + Exonic
1190984406 X:55488494-55488516 CCACGCCAGGCCCTGGGCCGCGG + Exonic
1191907404 X:66108100-66108122 CCATGCCTGGCCCGGGGTGGGGG - Intergenic
1192266656 X:69543391-69543413 CCGGCCCAGGCCCTGGCTTGAGG - Intergenic
1195221194 X:102746349-102746371 CCGAGCCAGGCCAAGGGCTGAGG + Intronic
1195615012 X:106905264-106905286 CCGTGCCAGGCCCTTGGGTTAGG - Intronic
1196836219 X:119816446-119816468 GTGTGCCAGGCCCTGGGGTCAGG - Intergenic
1197764023 X:130047784-130047806 ATGTGCCAGGCACTGGGTTTAGG + Intronic
1198675405 X:139125689-139125711 CAGTGCCTGGCCCTGTGTTAGGG + Intronic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199976395 X:152897349-152897371 GTGTGCAAGGCCCTGGGCTGGGG - Intergenic
1200092830 X:153643882-153643904 GCGTGCCAGGCCCTGCACTGGGG + Intronic
1200916796 Y:8578403-8578425 CCGTGCAAGGCCCAGGATTATGG + Intergenic