ID: 1078061106

View in Genome Browser
Species Human (GRCh38)
Location 11:8045088-8045110
Sequence TCTCCTTTCCCCAGTGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 429}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078061102_1078061106 8 Left 1078061102 11:8045057-8045079 CCATTGGTGAGTGAACTCAATCT 0: 1
1: 26
2: 58
3: 65
4: 132
Right 1078061106 11:8045088-8045110 TCTCCTTTCCCCAGTGGCTTAGG 0: 1
1: 0
2: 2
3: 47
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078061106 Original CRISPR TCTCCTTTCCCCAGTGGCTT AGG Intronic
900362082 1:2293977-2293999 TCTCCTTTCATCTGTGGCCTCGG + Intronic
900398841 1:2464617-2464639 CCTGCTTTCTCCATTGGCTTGGG - Intronic
900612837 1:3551637-3551659 TCTCCTGTCCCCTGTGGCTGTGG - Intronic
900794756 1:4701173-4701195 TCCCCTTTCCCCAGGAGCTCTGG - Intronic
901399590 1:9006846-9006868 TGTCCTGTTGCCAGTGGCTTCGG - Intronic
902068302 1:13708439-13708461 TCTGCTGTTCTCAGTGGCTTTGG - Intronic
902738357 1:18416275-18416297 TCTCCCTGTCCCAGTGTCTTTGG - Intergenic
903260917 1:22131555-22131577 TTTCCTTTTCCCCGTGGCTGTGG + Intronic
903413458 1:23166216-23166238 TCTACTTTGCCCACTGCCTTGGG - Intronic
904215461 1:28914981-28915003 TCCCCTTTCCTCAGCGGCTCTGG - Intronic
904299497 1:29545002-29545024 TCTCCCTTCCACAATGGCTGAGG + Intergenic
906715405 1:47965153-47965175 TCCCTGTTCCCTAGTGGCTTTGG - Intronic
907755918 1:57310595-57310617 TTTCCTTTCCAGAGTTGCTTGGG - Intronic
908102555 1:60807062-60807084 TTTGGTTTCCTCAGTGGCTTAGG + Intergenic
909301689 1:74020779-74020801 TCTCATATCCCTAGAGGCTTGGG + Intergenic
909839303 1:80298487-80298509 TCTCCTTTACATAGTGGCTATGG + Intergenic
910757129 1:90706063-90706085 CCTCCAGTCCCCAGAGGCTTTGG + Intergenic
911364284 1:96917979-96918001 TCCCCTTCCCCCACTGCCTTTGG - Intergenic
912164603 1:107028358-107028380 TACCCTTTCCCCATTGGCTCGGG - Intergenic
912549262 1:110474096-110474118 TCTCCCTTCCCCAGTAGCACTGG + Intergenic
912652440 1:111451325-111451347 TCTCTTTTCCCCAGATGATTGGG + Intronic
915193646 1:154172847-154172869 TATCCCTTCCCCTTTGGCTTGGG - Intronic
915213876 1:154327846-154327868 TCTCCTTTCCCTACAGGCATGGG + Exonic
915227227 1:154419998-154420020 TCTCCCTGCCCCGGTGGCCTAGG - Intronic
915263192 1:154694423-154694445 TCTCCTCTCCCCTCTGCCTTTGG + Intergenic
915404830 1:155651918-155651940 TTTTCTTTCCCCAGTGGTTAAGG + Intergenic
918781009 1:188701207-188701229 TGTGATTTCCTCAGTGGCTTGGG + Intergenic
919775715 1:201192784-201192806 TCAGCTTGCCCCATTGGCTTTGG - Intronic
920116842 1:203627572-203627594 TCCCCTTCCCCCCTTGGCTTGGG + Intronic
920562196 1:206946892-206946914 TCTCATATCCCCAGTTGCTCTGG + Intergenic
921966615 1:221097060-221097082 TCTCCTTTCCCCAGTTTCTCTGG + Intergenic
922117849 1:222631657-222631679 TCTCCTCTCCTAAGAGGCTTAGG - Intronic
923788172 1:237088155-237088177 TTTCCAATCCCAAGTGGCTTGGG + Intronic
923981242 1:239326666-239326688 TCACCATTGCCCAGTGGCATAGG - Intergenic
924068625 1:240253878-240253900 TGTAATTTCCTCAGTGGCTTAGG + Intronic
924209271 1:241748130-241748152 TGCCCTTCCCTCAGTGGCTTAGG - Intronic
924460517 1:244254636-244254658 TGTCCCTTCCCCAGCGACTTGGG - Intergenic
1062865219 10:846785-846807 TCTTCCTTCCCTTGTGGCTTCGG - Intronic
1064668998 10:17689029-17689051 CTTCCTTTCCCCAGTGGATATGG + Intronic
1064800180 10:19061671-19061693 TGTCCTTTCCCCATTGGTCTTGG - Intronic
1065150661 10:22819795-22819817 TAACCTTTCCTCAGTGTCTTAGG + Intergenic
1066689020 10:38008339-38008361 TGTCCCTTCCCCATTGGCTGGGG - Intergenic
1067399353 10:45956756-45956778 TACCCTTTCCCCATTGGCTGGGG + Intergenic
1067430685 10:46241447-46241469 TGTGATTTCCCTAGTGGCTTAGG - Intergenic
1067750132 10:48966260-48966282 TCTCCTTTCCCAAGCTGCTTGGG - Intronic
1067779377 10:49188403-49188425 TGTCCTGTCCCCAGAGCCTTGGG - Intronic
1067867671 10:49925972-49925994 TACCCTTTCCCCATTGGCTGGGG + Intronic
1068300918 10:55137880-55137902 CCTCCTGCCCCCAGTAGCTTTGG - Intronic
1068796638 10:61089493-61089515 TATCCTTTCCCCTGGGGGTTGGG - Intergenic
1068932898 10:62609844-62609866 GCTCTTTTCCCCACTGGCATAGG - Intronic
1069615953 10:69806291-69806313 CCTGCTTTCCCCATTGGCATGGG - Intronic
1069956357 10:72054266-72054288 TCTCCCTTCCCCAGCGGTTGGGG - Intergenic
1071014696 10:80982290-80982312 TCCCCTCTCTCCAGTGTCTTAGG + Intergenic
1073115587 10:101089821-101089843 TCTCCTTTCCCAAGAGGCCATGG - Exonic
1073214556 10:101829340-101829362 TCTCCTTACCTCAGTGTCCTTGG - Intronic
1073645238 10:105294433-105294455 TGTAATTTCCTCAGTGGCTTAGG - Intergenic
1074344114 10:112664795-112664817 TCTCCTTTCCACAGTGGTCCTGG - Intronic
1074402196 10:113151467-113151489 TGTGCTTTCCCCTCTGGCTTGGG + Intronic
1075206451 10:120453454-120453476 TCTTCTTTCTCCAGTCCCTTTGG - Intergenic
1075423093 10:122318961-122318983 TTTCATTTCCCCAGTGACTAAGG + Intronic
1075569805 10:123531847-123531869 ACTGCTTTCCACAGTGGCTGAGG + Intergenic
1075595713 10:123727696-123727718 CCTCCTGTTACCAGTGGCTTAGG + Intronic
1075597032 10:123739600-123739622 TTTTCTTTCTCCAGTGGCCTGGG + Intronic
1076108666 10:127844965-127844987 TCTCCATCCCACAGTGGCCTGGG - Intergenic
1076209863 10:128631765-128631787 TCTCCCTTCCCCAGTCCCTCTGG - Intergenic
1076666380 10:132095299-132095321 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1076979443 11:196840-196862 TGTCCTTTCCCCCCTGGCCTTGG - Exonic
1077307752 11:1875618-1875640 TCTCCCTTGCCCACTGGCGTGGG + Intronic
1077808206 11:5610548-5610570 TCTACTTACCCCAGTAGCTTTGG - Exonic
1077813779 11:5665647-5665669 TCTCCTTACCCCAGTAGCGTCGG + Exonic
1077973377 11:7220323-7220345 TCTCCTTTTCCCACTGTTTTTGG - Intergenic
1078061106 11:8045088-8045110 TCTCCTTTCCCCAGTGGCTTAGG + Intronic
1078320334 11:10328665-10328687 TCTCCTCTCCCTGGTGACTTAGG - Intronic
1079656534 11:22992847-22992869 TGTCCTTTCCCCATTGGTTGGGG + Intergenic
1080928371 11:36782330-36782352 TCTCCTGTCCCCACTTCCTTAGG + Intergenic
1083235799 11:61350079-61350101 TCTGCTTTCCTTGGTGGCTTTGG - Exonic
1083383242 11:62285978-62286000 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1083533409 11:63446453-63446475 TCTCCTTCATCCAGTGGCTTTGG - Intergenic
1083573248 11:63771083-63771105 TCCCCTTCCCCCAGTGGGGTTGG - Intergenic
1083718813 11:64593874-64593896 TCTCCTTTCCCTGGGGGCTGGGG + Intronic
1084648544 11:70474659-70474681 CCTCCCCTCCCCAGTGGCTGTGG - Intronic
1086289993 11:85297672-85297694 TCTACTTCACCCAGTGGCTTTGG - Intronic
1086646625 11:89230264-89230286 TGTCCTTTCCCCATTGTTTTTGG - Intronic
1087009434 11:93499457-93499479 TCCCCTCTCCCAACTGGCTTAGG + Intronic
1087304614 11:96473476-96473498 TGTGATTTCCACAGTGGCTTAGG - Intronic
1087757688 11:102072917-102072939 TGTGTTTTCCTCAGTGGCTTAGG + Intronic
1088054211 11:105555632-105555654 TCTACATTCCCCAGAGGCTGGGG - Intergenic
1088313362 11:108483593-108483615 TGTTCTTTGCCCAGTGGCTGGGG - Intronic
1088853080 11:113721459-113721481 TCTCCCTTCCCCAGTGCCCAAGG + Intergenic
1089090299 11:115869306-115869328 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
1089140289 11:116278860-116278882 TCCCCTCACCCCAGTGCCTTTGG + Intergenic
1089203734 11:116741380-116741402 TCTCTTTTTGCCAGGGGCTTGGG - Intergenic
1089517754 11:119044620-119044642 TCTCCTTTCCCCAGGATCTTGGG + Exonic
1090617874 11:128532661-128532683 TTTTTTTTCCCCAGTGACTTTGG + Intronic
1091597950 12:1891288-1891310 TGTGATTTCCTCAGTGGCTTAGG - Intronic
1091623148 12:2105188-2105210 TCCGCTTTTCCCATTGGCTTGGG + Intronic
1091911910 12:4239862-4239884 TGTCATTTCTTCAGTGGCTTAGG + Intergenic
1092330332 12:7581194-7581216 TCTCCTATCCCCAGAGGTTGGGG - Intergenic
1092503871 12:9074849-9074871 TCTCATTTCAGCACTGGCTTGGG - Intronic
1092770771 12:11894535-11894557 TCTCCTTTCACCAGTATGTTTGG + Exonic
1092989902 12:13886620-13886642 TCTCCTTTCCCTGCTGGCTGCGG - Intronic
1093027590 12:14258873-14258895 TTTCCCTTCCCCAGTCTCTTAGG - Intergenic
1094005254 12:25742215-25742237 TCTGCTTTCCCCTGGGGCCTTGG - Intergenic
1094018694 12:25891410-25891432 TGTCCTTACCCCATTGGCTAGGG - Intergenic
1094616912 12:32044222-32044244 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1095212635 12:39510870-39510892 TGTGATTTCCTCAGTGGCTTAGG - Intergenic
1095681772 12:44985732-44985754 TCTCCTTTGACTAGTGGGTTAGG + Intergenic
1095802476 12:46282495-46282517 TGTGATTTCCTCAGTGGCTTAGG - Intergenic
1096717974 12:53502277-53502299 TCTCCTTCCCTCACTGGCCTTGG - Intronic
1096810522 12:54166759-54166781 TCTCCTGTCCCCTGTGCCTGAGG - Intronic
1096913281 12:55005419-55005441 CCTCCTTTCCCCCGTTGCTCAGG - Intergenic
1098097626 12:66976055-66976077 TCTCCCTTCCCCAGTTGCATAGG + Intergenic
1098180200 12:67839663-67839685 TCTGACTTCCTCAGTGGCTTAGG + Intergenic
1099133819 12:78867255-78867277 TCTCATTTCTCCACTGTCTTAGG + Intronic
1100430759 12:94530113-94530135 TGTGCTTTCCCCTGTAGCTTTGG + Intergenic
1101571671 12:105959304-105959326 TCTCCCTTCCCCAGAGGTTGGGG + Intergenic
1102285569 12:111653573-111653595 TTTCTTTCCCCCAGTGCCTTAGG - Intronic
1102770673 12:115473288-115473310 TCTCCTCAACCCAGTGACTTCGG + Intergenic
1103197750 12:119059872-119059894 TCTCCTTTCCCCAGAGATTCTGG - Intronic
1104544604 12:129699870-129699892 TCTCCTTTCCTCACGGTCTTTGG + Exonic
1104553919 12:129782571-129782593 TCCCCTTTTCCCAGTGGCTGGGG - Intronic
1104665326 12:130643474-130643496 TCTCCTGTCCCCAGTCCCATGGG - Intronic
1106136873 13:26980041-26980063 TCCCCTTTCCCAAGTGCCTGGGG - Intergenic
1106362691 13:29046953-29046975 TACCCTTTCCCCATTGGCTGGGG - Intronic
1106611655 13:31288604-31288626 TGTAATTTCCTCAGTGGCTTAGG - Intronic
1107624217 13:42266711-42266733 TCATCTTTCCCCAGGAGCTTTGG - Intergenic
1108308758 13:49165451-49165473 TGTGATTTCCACAGTGGCTTAGG + Intronic
1108578803 13:51811367-51811389 ACCCCTTTCCCCAGTGACTTGGG + Intergenic
1109225376 13:59688051-59688073 TTTTCTTCCCCCAGTTGCTTTGG + Intronic
1109228088 13:59721647-59721669 TTGCCTTTCACCAGTGACTTAGG + Intronic
1109502008 13:63249959-63249981 TCCCATTTCCCCAGTGCCTGTGG - Intergenic
1109681669 13:65758934-65758956 TGTGATTTCCACAGTGGCTTAGG - Intergenic
1109704706 13:66074436-66074458 TCTCCTTTCCCCATTGCCAGAGG - Intergenic
1110630374 13:77698887-77698909 GCTCTTTTCCCCAGTGTTTTCGG + Exonic
1110746793 13:79063396-79063418 CCTCCTTTTCCCGGTGGTTTGGG - Intergenic
1110793528 13:79611866-79611888 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1111791021 13:92855255-92855277 ACTCTTTTCCTCAGTGGATTAGG + Intronic
1112174014 13:97003714-97003736 TGTTCTGTACCCAGTGGCTTTGG + Intergenic
1112438066 13:99405710-99405732 TCTCCTTTCCCCAGGAGCTAGGG + Intergenic
1113536922 13:111075736-111075758 TCTGATTTCTTCAGTGGCTTAGG + Intergenic
1114227465 14:20752247-20752269 TGTCCTTTCTCCATTGGCTGGGG - Intergenic
1114578037 14:23731002-23731024 TCCCCTCTCCCCAGAGACTTAGG - Intergenic
1114722674 14:24898997-24899019 TCTCCGTTCCCCAGAGGTTGGGG + Intronic
1115510802 14:34136319-34136341 TCACCTTTCACCTTTGGCTTTGG - Intronic
1116567088 14:46461606-46461628 TGTCCTTTCCCCAATGTTTTTGG - Intergenic
1117464917 14:55983267-55983289 TCTCCATCACCCAGAGGCTTGGG - Intergenic
1118190240 14:63573408-63573430 TCCCCTTTCCCCAGTCCATTGGG - Intergenic
1118625361 14:67654061-67654083 TTCCCATTCCCCAGTGGCCTTGG + Intronic
1119331341 14:73796303-73796325 GCTCCTGTCCTCAGTTGCTTTGG + Intergenic
1120150095 14:81023139-81023161 TCTGCTTTACTCAGTGTCTTAGG - Intronic
1120877791 14:89390979-89391001 ACTCCTTTCTCCAGTTGCTAAGG + Intronic
1121238203 14:92408851-92408873 TATCCTTTCCTCAGTGGTTGTGG + Intronic
1121673699 14:95734265-95734287 TGTCGTTTCCCCATTGGCTAGGG + Intergenic
1121784636 14:96648583-96648605 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
1121877513 14:97467046-97467068 TATCCTTTTCCCATTGGCTTGGG + Intergenic
1122289647 14:100673446-100673468 TCTCCTGTTACCAGGGGCTTTGG - Intergenic
1122586061 14:102807338-102807360 CCTCCTTTCTCCAGGGGCCTGGG + Intronic
1122834829 14:104425497-104425519 TCTCCTGTGCCCAGGGGCTGTGG + Intergenic
1124898447 15:33799346-33799368 TCTCCTCTCCCCAGAGGTTAGGG - Intronic
1125405158 15:39345152-39345174 TCCCCTTCTCCCAGAGGCTTTGG + Intergenic
1126490243 15:49229248-49229270 TCTGATTTCCTCAGTGACTTAGG + Intronic
1127720852 15:61697892-61697914 TCACATTGCCTCAGTGGCTTTGG - Intergenic
1128135075 15:65256884-65256906 TCTCCTTCCCCCAGAGGAATTGG - Intronic
1130166066 15:81460595-81460617 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
1132350661 15:101137991-101138013 TGTCCTCTGCACAGTGGCTTGGG - Intergenic
1132763581 16:1523442-1523464 TCTCCTGTCCCCAGAGGCTGTGG - Intronic
1132872720 16:2122912-2122934 TTTCCTTTCTCCCGTGGCCTGGG - Intronic
1133682109 16:8129398-8129420 TGACCTTTCCCCATTGGCTGGGG + Intergenic
1133912476 16:10078559-10078581 TCTCCTGCCCCCAGGGGCTGGGG - Intronic
1133962268 16:10504871-10504893 TGTCCTTTCCCCATTGGCTGAGG - Intergenic
1134551807 16:15142091-15142113 TTTCCTTTCTCCCGTGGCCTGGG - Intergenic
1135743777 16:24998467-24998489 CCACCTTTCCCCAGTGTCTGAGG - Intronic
1135752583 16:25068832-25068854 CCACCTTTCCCCAGTGTCTGAGG + Intergenic
1136414927 16:30097010-30097032 TGTCCTTTCCCCATTGGCTGGGG - Intergenic
1136415956 16:30103977-30103999 TGTCCTTTCCCCATTGACTGGGG - Intergenic
1136578889 16:31140407-31140429 TCTCCTCTCCCCAGTCCCTGTGG - Exonic
1137537328 16:49337342-49337364 TCCCCTTGCCAGAGTGGCTTGGG + Intergenic
1137897961 16:52234544-52234566 TCTCATTGCCCAAGTGTCTTAGG - Intergenic
1138491952 16:57382224-57382246 ACTGCTTTCGCCTGTGGCTTCGG - Exonic
1138878519 16:60981525-60981547 TCTCCTTTTCCAAGTCACTTAGG - Intergenic
1139476466 16:67205015-67205037 TCTTCTTTCCTCACGGGCTTGGG - Intergenic
1139653444 16:68373967-68373989 ACCCCTTGCCCCGGTGGCTTAGG + Intronic
1142205612 16:88781579-88781601 GCTGCTTTCCTCTGTGGCTTGGG - Intronic
1142553837 17:758469-758491 ACTCCTTTTCCCAGTGTATTGGG - Intronic
1142813353 17:2406896-2406918 TCTCCATTCCTGAGTGGCCTGGG - Intronic
1143715901 17:8768787-8768809 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1143742887 17:8966676-8966698 ACTCCCTTCCCCAGGGGCTGGGG - Intergenic
1144081866 17:11770354-11770376 TCTGCTTTCCCCAGTGCCCCTGG + Intronic
1145880508 17:28349396-28349418 GGTCCTTTGCCCAGTGCCTTCGG - Intronic
1146547241 17:33749804-33749826 TCTCCAATCCACACTGGCTTTGG - Intronic
1146568983 17:33937019-33937041 TCTCCCTTCCTCAGTGACTCTGG + Intronic
1146919911 17:36703614-36703636 TCTCTCTTCCCCAGTGGTCTGGG - Intergenic
1147521594 17:41178384-41178406 TCTCCTTTCCCTAATGTGTTAGG + Intergenic
1148394851 17:47299669-47299691 TCTCCTTTTGCCAAAGGCTTTGG + Intronic
1148682287 17:49481482-49481504 TCTCCCTTCCCCAGTAGATCTGG + Intergenic
1149969286 17:61200411-61200433 TCTCCTTTACCAAGTTGCTATGG - Intronic
1150893283 17:69179579-69179601 TTTCTTTTCCCCAGTGTTTTGGG - Intronic
1151069774 17:71195533-71195555 TCTCCATTTCCTAATGGCTTGGG - Intergenic
1151777244 17:76213740-76213762 TCTCCCTTCCTCAGTGGTTGGGG - Intronic
1152224279 17:79085528-79085550 TCTCCCTTCTGCTGTGGCTTGGG + Intronic
1154198410 18:12282466-12282488 TCTCCCTTCCCCAGAGGTTGGGG - Intergenic
1156027263 18:32669602-32669624 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
1156135590 18:34032912-34032934 TGTGATTTTCCCAGTGGCTTAGG - Intronic
1156407303 18:36795243-36795265 TCTTAGTTCCCCAGTGGGTTTGG + Intronic
1157396145 18:47343267-47343289 TCTCCCTTCCCCAGAGGATGAGG + Intergenic
1157820951 18:50767886-50767908 TGTTATTTCCTCAGTGGCTTAGG - Intergenic
1157934163 18:51855622-51855644 TCTCCCATCCCCAGGGCCTTGGG - Intergenic
1158178763 18:54687987-54688009 TCTCCTTGCTGCAGTGACTTTGG - Intergenic
1158373799 18:56840179-56840201 TCCCCTTTCCCCCTTGTCTTAGG - Intronic
1158407814 18:57175899-57175921 ACTCCTGGCCCCAGTGGGTTGGG - Intergenic
1160103619 18:75947705-75947727 TCTGCTTTCCACAGAGCCTTTGG - Intergenic
1161393723 19:4034051-4034073 CCTCCTGTCCCCTGTGGCCTGGG - Intronic
1161959977 19:7517815-7517837 TTGTCTTTCCCCAGTGACTTGGG + Intronic
1162221196 19:9178161-9178183 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1162617671 19:11814913-11814935 TGTCCTTTCCTCATTGGCTAGGG + Intronic
1164392770 19:27840410-27840432 ACTCTTTTCCCCAGGGGCTGTGG + Intergenic
1164891548 19:31827857-31827879 TCAGCTTTCCCCACTGGCTTGGG + Intergenic
1164979848 19:32605700-32605722 GCTCCTCTCCCCAGAGGCCTGGG + Intronic
1165008068 19:32822774-32822796 TCTCCTTCCACAAGGGGCTTGGG - Intronic
1166165458 19:40984556-40984578 TGTGATTTCCCCATTGGCTTAGG - Intergenic
1166655425 19:44607730-44607752 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1166903565 19:46086910-46086932 TTTCATTTTCTCAGTGGCTTAGG + Intergenic
1167518955 19:49940575-49940597 TCTGACTTCCTCAGTGGCTTAGG - Intronic
1167707811 19:51091972-51091994 TATCCTCTCCCCAGGTGCTTGGG + Intergenic
1167712310 19:51119942-51119964 CCTTCTCTCCCCAGGGGCTTTGG + Intergenic
1168061892 19:53897945-53897967 TCTCCTTTCCACAGCGGGTGCGG + Exonic
1168378573 19:55901304-55901326 TGCCCTTTCCCCATTGGCTGGGG + Intronic
924960928 2:33817-33839 TCACCTTTTCCCGGTGGCTTTGG - Intergenic
925192687 2:1898496-1898518 TCTCTTTTCCTCAGTGTCCTTGG + Intronic
925685574 2:6469444-6469466 TCTTCTTTTTCCAGTGTCTTAGG + Intergenic
925764191 2:7214958-7214980 AAGCCTTTCCCCAGGGGCTTGGG + Intergenic
925821745 2:7805499-7805521 GCTCCTTAGGCCAGTGGCTTTGG - Intergenic
925915174 2:8599851-8599873 TCCCCTTGCCCCAGTGGACTTGG - Intergenic
926767934 2:16338481-16338503 TGTGATTTCCTCAGTGGCTTAGG - Intergenic
927090580 2:19707763-19707785 GCTCTTTTCAGCAGTGGCTTGGG + Intergenic
927192092 2:20523924-20523946 TCTCCTGGCCCCAGTGGGTCTGG - Intergenic
927929711 2:27036407-27036429 TCTCCCTTCCCTCCTGGCTTTGG + Intronic
928485619 2:31728499-31728521 TCTCCCTTCCCCAGGTGCTCAGG - Intergenic
928913782 2:36449698-36449720 TCTCCTGTCGCTAGCGGCTTGGG - Intronic
929804532 2:45133004-45133026 TTCCCTTTCCCCAGTGATTTAGG - Intergenic
929812442 2:45201566-45201588 TGTGATTTCCTCAGTGGCTTCGG - Intergenic
930226382 2:48798481-48798503 TCTCCCTTCCCCATTTGCTGTGG + Intergenic
930679445 2:54240816-54240838 TTTCCTTGCTTCAGTGGCTTAGG + Intronic
930768744 2:55111381-55111403 TCTGCTTTCCACAGTTGCTATGG - Intronic
931854129 2:66283625-66283647 TCCTCTTTCCACAGTGGATTCGG + Intergenic
933027392 2:77277593-77277615 TTACCATTCTCCAGTGGCTTAGG - Intronic
933364991 2:81341225-81341247 TTTCATTTCCCTAGTGACTTTGG - Intergenic
934270426 2:91530337-91530359 TCTCCAGTCCACAGTGGCCTGGG + Intergenic
934951427 2:98578347-98578369 TCTCCTTTCTTCACTGGCTGAGG - Intronic
935143569 2:100377686-100377708 TCTCCTGTCCCCAGTGTTTTAGG + Intergenic
936040020 2:109142551-109142573 TCTGCTCTCCCCAGTGGCTGAGG + Intronic
938216506 2:129522392-129522414 TCCCCTTTCCCCTGTGGGTGGGG + Intergenic
938238104 2:129722728-129722750 TCTCCTCTCCCCAGAGCCTGAGG + Intergenic
938628440 2:133137926-133137948 TACCCTTTCCCCATTGGCTGAGG + Intronic
938793882 2:134702249-134702271 GCTTCTTTCCCCTGTTGCTTTGG - Intronic
939003915 2:136765103-136765125 TCTCCTGGGCTCAGTGGCTTGGG + Intergenic
939350893 2:141036454-141036476 TTTCTCTTCCCCAGTGGTTTAGG - Intronic
940362561 2:152812596-152812618 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
940907197 2:159179927-159179949 TCTGCTGTCTCGAGTGGCTTCGG + Intronic
941447216 2:165617439-165617461 TCTACGTTCCTCAGTGGCTTAGG + Intronic
941963899 2:171281663-171281685 TCACCTGTCTTCAGTGGCTTAGG + Intergenic
941997340 2:171612726-171612748 TATGATTTCCTCAGTGGCTTAGG - Intergenic
942943512 2:181647480-181647502 TCTGATTTCCTCAGTGGCCTAGG - Intronic
942997011 2:182275162-182275184 TCACCAGACCCCAGTGGCTTTGG + Intronic
943403853 2:187454257-187454279 TGTGATTTCCTCAGTGGCTTAGG - Intergenic
944643027 2:201747411-201747433 TCCCCTTCCCCCAGTAGCTCTGG - Intronic
945864615 2:215162139-215162161 TCCCCTTTTCCCAGTGGATGTGG - Intergenic
946782661 2:223206533-223206555 TCTGAGTTCCCTAGTGGCTTAGG - Intergenic
948141250 2:235673391-235673413 CCACCTGTCCCCAGTGGTTTGGG - Intronic
948288222 2:236803800-236803822 GCTCCTTTACCCTCTGGCTTCGG + Intergenic
948650583 2:239440998-239441020 TCTCCTTCCCCCACTGGCACGGG + Intergenic
948875759 2:240826975-240826997 TCTCCTCTCCCCAGAGGCTGAGG - Intergenic
1169130177 20:3162799-3162821 TCTCCCTGCCCCTGTGGCCTAGG + Exonic
1169272397 20:4210698-4210720 TTTCCCTGCCCCATTGGCTTTGG + Intergenic
1170986626 20:21265270-21265292 TTTCCTCTCTCCAGTCGCTTGGG + Intergenic
1171501079 20:25593779-25593801 CCTCCTTTCCCCAGGGCCTTTGG + Intergenic
1171945518 20:31373708-31373730 CCTTTTTGCCCCAGTGGCTTTGG + Exonic
1173270831 20:41533236-41533258 TCTCGTTTCCTCTTTGGCTTGGG + Exonic
1173730561 20:45325502-45325524 CCTCCTGACCCCAGTGGCTGCGG - Exonic
1174038284 20:47681608-47681630 TCTCCGTGCCTCAGTGGCCTTGG + Intronic
1174138356 20:48395938-48395960 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1174683827 20:52434449-52434471 TTTCCTTCCTCCAGTGGCTCAGG + Intergenic
1174864648 20:54123904-54123926 TCTCCTTACCTGACTGGCTTTGG - Intergenic
1175391740 20:58631836-58631858 TCTCCTTTCTCCTGGGGCCTGGG - Intergenic
1175442630 20:59002174-59002196 TCTGCATCCCCCAGTGCCTTCGG - Intronic
1177267584 21:18804474-18804496 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1177681294 21:24375090-24375112 TCTCCTTTCCCCTATGGATGGGG + Intergenic
1178041834 21:28647798-28647820 TCTCCTTTCCACTCAGGCTTGGG + Intergenic
1179008750 21:37536946-37536968 TGTCCTTCCCCCATTGGCTGGGG + Intergenic
1179191124 21:39122191-39122213 TTTGATTTCCTCAGTGGCTTAGG - Intergenic
1179649182 21:42795663-42795685 TACCCTTTCCCCATTGGCTGGGG - Intergenic
1180126206 21:45791979-45792001 TTTCCTTGCTCCAGTCGCTTGGG + Intronic
1180153725 21:45966841-45966863 ACTCCTTTCCCCAGGGTCTAGGG - Intergenic
1181350325 22:22250657-22250679 TCTCCAGTCCACAGTGGCCTGGG + Intergenic
1182738791 22:32551195-32551217 CAGCCTTTCCCCAGTGGCCTTGG - Intronic
1182742629 22:32579694-32579716 TGTCCTTGCCCCAGCCGCTTGGG + Intronic
1183758929 22:39798522-39798544 TGTGATTTCCTCAGTGGCTTAGG + Intronic
1184673688 22:46028700-46028722 GCTCACTTCCCCAGAGGCTTGGG - Intergenic
1185323344 22:50212933-50212955 TCTTCTTTCTCCAGTTCCTTAGG + Intronic
950227432 3:11247434-11247456 TGTCCTTTCCTCATTGGCTAAGG + Intronic
950228393 3:11254902-11254924 TGTCCTTTCCGCATTGGCTGGGG + Intronic
951041932 3:17997691-17997713 TCTCCTTTCCCTATTTGCTGAGG - Intronic
951337380 3:21441047-21441069 CTTCTTATCCCCAGTGGCTTGGG - Intronic
951715066 3:25633526-25633548 TCTCCTCTCCCCAGAGGTTGGGG + Intronic
951868622 3:27334596-27334618 TGAGATTTCCCCAGTGGCTTAGG - Intronic
952235366 3:31473569-31473591 TCTGATTTCCCCAGTCTCTTGGG - Intergenic
953046693 3:39298938-39298960 TGTGATTTCCTCAGTGGCTTAGG - Intergenic
953059438 3:39415039-39415061 TCTACTTTCCTAAGTAGCTTAGG + Intergenic
953106910 3:39890680-39890702 ACTCCTTTCTCCACTGGCTTTGG - Intronic
953707379 3:45241360-45241382 TCCCCGTTCCCCAGTACCTTGGG + Intergenic
954123355 3:48513784-48513806 ACTCCTTTCCCCAAAGCCTTGGG + Intergenic
954674075 3:52306124-52306146 TCTCCTTGCCCCATTGACGTGGG - Intergenic
955828437 3:62974766-62974788 ACTCCTTCCCCCAGTTTCTTTGG - Intergenic
957290002 3:78267960-78267982 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
958855393 3:99377716-99377738 TGTACTTTCCTTAGTGGCTTAGG - Intergenic
959095991 3:101956438-101956460 GCTCCTTTCCCCAGTGAGGTTGG - Intergenic
959195148 3:103170839-103170861 TCTCCTCTCCCCAGGGGTTGAGG - Intergenic
960014450 3:112871306-112871328 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
960536771 3:118823762-118823784 TCTCCTTTCTCCTGTGCCCTGGG - Intergenic
961109828 3:124274505-124274527 TCTCCTTTCCAGAATAGCTTTGG - Intronic
961214870 3:125151515-125151537 TGTCCAGTCCCCACTGGCTTTGG + Intronic
961310636 3:125997113-125997135 ACTCCTTTCCCCAGGTGCTCTGG - Intergenic
966118349 3:176492244-176492266 TCTCATTTCCTCAGCTGCTTTGG + Intergenic
966360512 3:179123882-179123904 TGTGATTTCCTCAGTGGCTTAGG - Intergenic
966469504 3:180273183-180273205 TCTCCTTCCACCATTGTCTTGGG + Intergenic
966833090 3:184027744-184027766 TTTCCTTTCCCATTTGGCTTGGG + Intergenic
966873567 3:184308232-184308254 TCGCATTTCCCCAGTGACTTAGG - Intronic
967651273 3:191989906-191989928 TGGCCTTTACCCAGTGGCTCTGG - Intergenic
969479146 4:7437967-7437989 TCTCTTTACCCCAGTTACTTTGG + Intronic
969916794 4:10499221-10499243 TCCCCTTTCCCCATTGGCTGGGG - Intronic
973207621 4:47577925-47577947 CCTCCTTTCCGAAGTGGATTTGG - Intronic
974734868 4:65916988-65917010 TCTCCCCTCTCCAGTGGCCTAGG - Intergenic
975491015 4:74988914-74988936 TGCCCTTTCCTCAGTGGTTTTGG - Intronic
975854331 4:78607097-78607119 TCTCCGTTCCCCAGTGGTCTGGG + Intronic
975917408 4:79341198-79341220 TGTAATTTCCTCAGTGGCTTAGG - Intergenic
976339979 4:83936004-83936026 TCTGCTTTACCCTGTGGCATAGG + Intergenic
976876854 4:89863255-89863277 TCTCCTTTCCACAGAGCCTGTGG - Intergenic
977926583 4:102706313-102706335 TGTGATTTCCTCAGTGGCTTAGG - Intronic
978311447 4:107388369-107388391 TACCCTTTCCCCATTGGCTGTGG - Intergenic
980525410 4:133985287-133985309 TTTCCTTTACCCTGTGACTTAGG - Intergenic
981543277 4:145868096-145868118 TCTTCTTTACCTTGTGGCTTAGG + Intronic
983779666 4:171651693-171651715 TGTGCTTTCCTCAGTGGCTTAGG - Intergenic
984993694 4:185406903-185406925 TATCCTTTCCTCAGTGGTTATGG - Intronic
985495156 5:200004-200026 TCTGCTTTCCCCATGGGGTTGGG + Exonic
985516801 5:350520-350542 TGTCCTCTCCCCACTGCCTTCGG + Intronic
986723970 5:10580748-10580770 TCTGCTTTTGCCAGTGGCTTTGG + Intronic
987274944 5:16352466-16352488 TCTCCTTTCCCCTGGGGATTAGG - Intergenic
987370435 5:17187938-17187960 TCTCCTTTCTTTAGTAGCTTTGG + Intronic
988237353 5:28562137-28562159 ACTGATTTCCTCAGTGGCTTAGG - Intergenic
988601382 5:32642335-32642357 TCTCCTTTCCCAGGGGCCTTTGG - Intergenic
988813564 5:34808570-34808592 TTTCCTTCCCCCAGCGGCTCAGG + Exonic
990570065 5:57069429-57069451 TGTCATTTCCCCATTGGCTAGGG + Intergenic
991195721 5:63929992-63930014 TACCCTTTCCCCATTGGCTGGGG + Intergenic
991311266 5:65245319-65245341 TCTCCTTTCCTCTGTGCCTTGGG + Intronic
993616730 5:90122326-90122348 GCTTCTTTCTCCAGTGCCTTGGG - Intergenic
994640438 5:102401830-102401852 GCTCCTTTGCCCTCTGGCTTTGG - Intronic
995082221 5:108065747-108065769 TCTCCTTTCCCAAGTAACCTTGG + Intronic
995594566 5:113734125-113734147 TCTCCTCTCCCCAGAGGTTAGGG + Intergenic
997767017 5:136514752-136514774 TTTCCTTCCTCCTGTGGCTTAGG - Intergenic
997781894 5:136667579-136667601 TCTGCATTCCCCAGTGGCAGGGG + Intergenic
997829541 5:137138147-137138169 TTTCCTTTTCCAAGTGGCCTTGG - Intronic
998215270 5:140233558-140233580 ACTCTTTTCCAAAGTGGCTTTGG + Intronic
998232912 5:140372935-140372957 TCTCCTTACTCCAGTCCCTTAGG + Intronic
998316803 5:141189677-141189699 TCTACTCTCCCCAATAGCTTTGG + Exonic
999179241 5:149657270-149657292 TCTCCTCTCCCCACTGCCTTGGG + Intergenic
999340955 5:150771551-150771573 TCTTCTTTTTCCAGTGTCTTAGG + Intergenic
999634682 5:153609510-153609532 TCACCTTAGCCCAGTGACTTTGG + Intronic
1001420214 5:171580625-171580647 TCTCCTTTTCACAGTGGCCTTGG + Intergenic
1002146614 5:177188070-177188092 TCTCTTTTCCCAAGTGTCTTGGG + Intronic
1004213742 6:13681433-13681455 TTCCCTTTCCCCAGTGTCTGTGG - Intronic
1005990368 6:30898451-30898473 CCTGCTTTCCCCAGTCCCTTGGG - Intronic
1006591570 6:35161829-35161851 ACTCATTTCCTCAGTGGCTGGGG + Intergenic
1007886093 6:45232335-45232357 TGTGCTTTCCCTGGTGGCTTAGG + Intronic
1008022861 6:46600537-46600559 CCTCCCTTCCCCAGAGGCTGGGG - Intronic
1008130522 6:47715513-47715535 TATCCTTTATCCAGTGGTTTGGG + Intronic
1009408741 6:63341067-63341089 TCTGAGTTCCTCAGTGGCTTAGG + Intergenic
1009552474 6:65116904-65116926 ACTCCCTTCCTCAGTGGTTTAGG + Intronic
1010254526 6:73742699-73742721 TCTTCTTTCTAGAGTGGCTTAGG + Intronic
1010269195 6:73901680-73901702 TGTGATTTCCTCAGTGGCTTAGG - Intergenic
1010500587 6:76594420-76594442 TCCCCTTTCCCCTGTGGATGAGG - Intergenic
1011670711 6:89680532-89680554 TCTGTTTTCCCCAGTGGCGCAGG - Intronic
1013352452 6:109317902-109317924 TTGCCTTTCCACAGTGGATTGGG + Intergenic
1014197719 6:118578391-118578413 TGTCCTTTCCCCATTGGCTAGGG - Intronic
1014308681 6:119771660-119771682 TGCCCTTTCCCCATTGGCTGGGG + Intergenic
1016814026 6:148287133-148287155 TCTCCTTCCTCCAGATGCTTGGG + Intronic
1017209823 6:151842844-151842866 TCTTCCTTCCTCAGTCGCTTTGG - Intronic
1017226039 6:152022180-152022202 TCTGCTTTCCTCAGAGGCTAAGG - Intronic
1017955091 6:159170358-159170380 TCGCCCTTCCCCAATGGCTGAGG + Intronic
1018191787 6:161315304-161315326 TATCCTTTCCCTATTGGCTAGGG + Intergenic
1018234373 6:161709182-161709204 TCTCCTTTCCCAAGAGTATTTGG - Intronic
1018869514 6:167770412-167770434 TCTGCCTTTCCCAGTGGCCTGGG + Intergenic
1020669017 7:11083126-11083148 TGCCCTTTCCCCATTGGCTGGGG - Intronic
1020781109 7:12518152-12518174 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
1021512527 7:21449906-21449928 TCTCCTATCCCAAGTGGCAGTGG + Intronic
1022111689 7:27236008-27236030 TCCCCCTTCCCAAGTGGGTTGGG - Intergenic
1022707628 7:32819420-32819442 TCTCCTTTTTACACTGGCTTTGG - Intergenic
1022915285 7:34943586-34943608 TCTCCTTTTTACACTGGCTTTGG + Intronic
1023080644 7:36523091-36523113 CCTCCATTCCCCAGGGGCTGAGG + Intronic
1023788923 7:43736669-43736691 GCTCATTACCCCACTGGCTTAGG - Intergenic
1023830238 7:44034942-44034964 ACTACTTTTCCCAGTGGCTCTGG + Intergenic
1024813214 7:53237597-53237619 TGCCCTTTCCCCATTGGCTGGGG + Intergenic
1026861460 7:73792829-73792851 TCTCCTCTCCCCAGAGGCTGAGG + Intergenic
1028638444 7:93016735-93016757 TGTCCTTCACCCAGTGGATTGGG + Intergenic
1029600062 7:101558190-101558212 TCCCCCTTCCCCACTGGCTGGGG + Exonic
1029601105 7:101563902-101563924 TCCCCTTTCCCCAGGGGCTGTGG - Intergenic
1029740556 7:102489229-102489251 ACTACTTTTCCCAGTGGCTCTGG + Intronic
1029758553 7:102588401-102588423 ACTACTTTTCCCAGTGGCTCTGG + Intronic
1029776491 7:102687480-102687502 ACTACTTTTCCCAGTGGCTCTGG + Intergenic
1030051099 7:105538378-105538400 TCTCCTGTCCCCATTACCTTAGG + Intronic
1031691766 7:124797269-124797291 TATCCTTCCCCCAGTGTCCTAGG - Intergenic
1035090811 7:156308439-156308461 TCTCATTGCCCCACTGGCCTGGG + Intergenic
1035207048 7:157300541-157300563 TCTCCTTTCCACACAGGCTCTGG - Intergenic
1035278553 7:157763189-157763211 TCTCCTTCCCACTGTGGCCTGGG - Intronic
1035554132 8:553051-553073 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
1035874219 8:3170014-3170036 TGTCCTTTCCCCATTGGCTGGGG - Intronic
1035910892 8:3565292-3565314 CCTCCTTTCCCCAGTGGCATGGG + Intronic
1037456109 8:19065834-19065856 TCTCCCATCCCCAGAGGCTAGGG + Intronic
1038131065 8:24732170-24732192 TTTCTTTTCCCCAGTCTCTTGGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1039707607 8:40023382-40023404 TCTCCTGTCTCCAGTGCCATTGG + Intergenic
1041494078 8:58466793-58466815 TCTCCTCTCCACTTTGGCTTAGG - Intergenic
1041647250 8:60265484-60265506 CCTCCCTCCCCAAGTGGCTTGGG + Intronic
1042448927 8:68922160-68922182 AGTACTTTCCCCAGTGCCTTGGG + Intergenic
1043305337 8:78786889-78786911 TCTCCTCTCCCCAGAAGCTGGGG - Intronic
1043867594 8:85393898-85393920 TCTTCTTAACCCACTGGCTTAGG + Intronic
1044422657 8:92015886-92015908 TATGCTTACCCCTGTGGCTTTGG + Intronic
1044792116 8:95858305-95858327 TCTCCCTTCCTCAGGGGCTGGGG + Intergenic
1045124828 8:99078442-99078464 TGTGATTTCCCCAGTGGCTTAGG + Intronic
1045958270 8:107935494-107935516 TTTACTGTCCCCACTGGCTTGGG - Intronic
1046224406 8:111259379-111259401 TGTCCTTTTCCCATTGGCTGGGG + Intergenic
1046254656 8:111680473-111680495 TCTCCTTTCCCTAGTGGAGGTGG - Intergenic
1046496287 8:115018835-115018857 TGTAATTTCCTCAGTGGCTTAGG + Intergenic
1047423048 8:124723078-124723100 TTTCCTTTTCCCTGTGGCTGAGG + Intronic
1048814971 8:138323990-138324012 TTTCCTGTCACCTGTGGCTTTGG - Intronic
1049616795 8:143579035-143579057 AATCCATTCCCCTGTGGCTTGGG + Intergenic
1051385483 9:16503481-16503503 TCCCCTTTCCTCACTGCCTTTGG - Intronic
1052303269 9:26976448-26976470 TGCCCTTTCCCCATTGGCTGGGG + Intronic
1053030850 9:34777000-34777022 TGTAATTTCCTCAGTGGCTTAGG + Intergenic
1053477719 9:38394058-38394080 TACCCTTTCCCCATTGGCTGGGG - Intronic
1055330507 9:75178316-75178338 TACCCTTTCCCCATTGGCTGGGG + Intergenic
1055563132 9:77542319-77542341 TGTGATTTCCTCAGTGGCTTAGG + Intronic
1057725181 9:97563471-97563493 TATCCTTTCCCCACTAGTTTGGG + Intronic
1058524225 9:105840854-105840876 TCTCCTTTATCCAGTGGGATGGG + Intergenic
1059275639 9:113094643-113094665 TTTCATGTCCCCAGTGGCTGAGG + Intergenic
1059398990 9:114057013-114057035 GCCCCTTTACCTAGTGGCTTTGG + Intergenic
1060213777 9:121726147-121726169 TCTCCCTGCCCCAGGGGCTGTGG - Intronic
1060912267 9:127360634-127360656 TCTCCTGTCCCCACTGCCCTGGG - Intronic
1061186664 9:129059061-129059083 TCCCCTTTCCCCAGGGACCTGGG + Intronic
1186156282 X:6729909-6729931 TATCCTTTTCCCATTGGCTGGGG - Intergenic
1186225176 X:7391111-7391133 TCACATTTTCCCAATGGCTTTGG + Intergenic
1187089678 X:16082555-16082577 TGTCCTTTCCCCAGTCCCGTAGG + Intergenic
1187830942 X:23380515-23380537 TCTCCTTGTCCCAGTGTCTTAGG + Intronic
1188414190 X:29912542-29912564 TCTCCTTTCTCCATAGACTTTGG - Intronic
1188556928 X:31422721-31422743 TTTCCTTTCACCAGTTACTTTGG + Intronic
1189047887 X:37612446-37612468 TCTCATTTCCCCAGCAACTTTGG + Intronic
1189276855 X:39792842-39792864 CCTCTTTTCCCCACTTGCTTTGG - Intergenic
1189372357 X:40438928-40438950 TACCCTTTCCCCATTGGCTTGGG + Intergenic
1191180036 X:57552569-57552591 TGTCCTTTCCCTATTGGCTGGGG - Intergenic
1191667619 X:63719677-63719699 TCCCCATTCCCCAGTGGCTGAGG + Intronic
1191693393 X:63963720-63963742 TCTTCTTCCTCCATTGGCTTTGG - Intergenic
1192157830 X:68759490-68759512 TCTTCTTTTCTCAGAGGCTTTGG + Intergenic
1192291188 X:69796431-69796453 TGTAATTTCCTCAGTGGCTTAGG - Intronic
1192496260 X:71618224-71618246 TCTCCTCTCCTCTCTGGCTTCGG - Intronic
1193689217 X:84619962-84619984 TTTCCCTTCCCCAGAGCCTTAGG + Intergenic
1195059080 X:101176913-101176935 TGTGATTTCCTCAGTGGCTTAGG + Intergenic
1195087206 X:101423759-101423781 TCTCCCTTCCCCAGAGGCTGGGG - Intronic
1195263142 X:103153692-103153714 TCTCCTGTCCCCAGTGAGTGTGG + Intergenic
1195555078 X:106212311-106212333 TTTCCTTAACCCAGTGGGTTAGG - Intergenic
1196194216 X:112822969-112822991 CCTCCTTTCCCCAGTGGCAGTGG - Exonic
1197684635 X:129426889-129426911 TGTGGTTTCCTCAGTGGCTTAGG + Intergenic
1198898366 X:141482127-141482149 TACCCTTTCCCCATTGGCTGGGG + Intergenic
1199357386 X:146877340-146877362 ACTGCTTTCCACAGTGGCTGAGG - Intergenic
1199900454 X:152167495-152167517 TCTTCTTCCCCCACTGCCTTTGG - Exonic
1200157602 X:153985538-153985560 CCTCCTTCCTCCAGTGGCTCAGG - Intergenic
1200273848 X:154713284-154713306 TCTGGTTTCCTCAGTGGCTACGG + Exonic
1200345504 X:155442622-155442644 ACTGATTTCCTCAGTGGCTTAGG - Intergenic
1200788510 Y:7279519-7279541 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1201912138 Y:19143592-19143614 TGTCCTTTCCCCAGTGGCTGGGG - Intergenic