ID: 1078062607

View in Genome Browser
Species Human (GRCh38)
Location 11:8057744-8057766
Sequence TTCTTAACAGGCCTCGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078062607_1078062613 23 Left 1078062607 11:8057744-8057766 CCTTAAACGAGGCCTGTTAAGAA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1078062613 11:8057790-8057812 TTAAGGCCCAGGAAAGGCCTAGG 0: 58
1: 118
2: 121
3: 88
4: 262
1078062607_1078062612 17 Left 1078062607 11:8057744-8057766 CCTTAAACGAGGCCTGTTAAGAA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1078062612 11:8057784-8057806 CATGCTTTAAGGCCCAGGAAAGG 0: 61
1: 112
2: 77
3: 69
4: 175
1078062607_1078062610 6 Left 1078062607 11:8057744-8057766 CCTTAAACGAGGCCTGTTAAGAA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510
1078062607_1078062611 12 Left 1078062607 11:8057744-8057766 CCTTAAACGAGGCCTGTTAAGAA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1078062611 11:8057779-8057801 TTTGTCATGCTTTAAGGCCCAGG 0: 61
1: 94
2: 97
3: 78
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078062607 Original CRISPR TTCTTAACAGGCCTCGTTTA AGG (reversed) Intronic