ID: 1078062608

View in Genome Browser
Species Human (GRCh38)
Location 11:8057756-8057778
Sequence ATAATGAAGGAATTCTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 70, 1: 101, 2: 99, 3: 77, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078062608_1078062612 5 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062612 11:8057784-8057806 CATGCTTTAAGGCCCAGGAAAGG 0: 61
1: 112
2: 77
3: 69
4: 175
1078062608_1078062613 11 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062613 11:8057790-8057812 TTAAGGCCCAGGAAAGGCCTAGG 0: 58
1: 118
2: 121
3: 88
4: 262
1078062608_1078062616 23 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062616 11:8057802-8057824 AAAGGCCTAGGCAAAACTCTTGG 0: 67
1: 118
2: 91
3: 50
4: 169
1078062608_1078062610 -6 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510
1078062608_1078062617 26 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062617 11:8057805-8057827 GGCCTAGGCAAAACTCTTGGTGG 0: 67
1: 122
2: 108
3: 71
4: 110
1078062608_1078062618 27 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062618 11:8057806-8057828 GCCTAGGCAAAACTCTTGGTGGG 0: 82
1: 117
2: 94
3: 60
4: 84
1078062608_1078062611 0 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062611 11:8057779-8057801 TTTGTCATGCTTTAAGGCCCAGG 0: 61
1: 94
2: 97
3: 78
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078062608 Original CRISPR ATAATGAAGGAATTCTTAAC AGG (reversed) Intronic