ID: 1078062609

View in Genome Browser
Species Human (GRCh38)
Location 11:8057769-8057791
Sequence AAAGCATGACAAAATAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 975
Summary {0: 34, 1: 63, 2: 71, 3: 136, 4: 671}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078062609_1078062618 14 Left 1078062609 11:8057769-8057791 CCTTCATTATTTTGTCATGCTTT 0: 34
1: 63
2: 71
3: 136
4: 671
Right 1078062618 11:8057806-8057828 GCCTAGGCAAAACTCTTGGTGGG 0: 82
1: 117
2: 94
3: 60
4: 84
1078062609_1078062616 10 Left 1078062609 11:8057769-8057791 CCTTCATTATTTTGTCATGCTTT 0: 34
1: 63
2: 71
3: 136
4: 671
Right 1078062616 11:8057802-8057824 AAAGGCCTAGGCAAAACTCTTGG 0: 67
1: 118
2: 91
3: 50
4: 169
1078062609_1078062613 -2 Left 1078062609 11:8057769-8057791 CCTTCATTATTTTGTCATGCTTT 0: 34
1: 63
2: 71
3: 136
4: 671
Right 1078062613 11:8057790-8057812 TTAAGGCCCAGGAAAGGCCTAGG 0: 58
1: 118
2: 121
3: 88
4: 262
1078062609_1078062612 -8 Left 1078062609 11:8057769-8057791 CCTTCATTATTTTGTCATGCTTT 0: 34
1: 63
2: 71
3: 136
4: 671
Right 1078062612 11:8057784-8057806 CATGCTTTAAGGCCCAGGAAAGG 0: 61
1: 112
2: 77
3: 69
4: 175
1078062609_1078062617 13 Left 1078062609 11:8057769-8057791 CCTTCATTATTTTGTCATGCTTT 0: 34
1: 63
2: 71
3: 136
4: 671
Right 1078062617 11:8057805-8057827 GGCCTAGGCAAAACTCTTGGTGG 0: 67
1: 122
2: 108
3: 71
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078062609 Original CRISPR AAAGCATGACAAAATAATGA AGG (reversed) Intronic