ID: 1078062610

View in Genome Browser
Species Human (GRCh38)
Location 11:8057773-8057795
Sequence CATTATTTTGTCATGCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 38, 1: 70, 2: 77, 3: 122, 4: 510}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078062608_1078062610 -6 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510
1078062605_1078062610 24 Left 1078062605 11:8057726-8057748 CCAATAAAACTTGTTTAACCTTA 0: 1
1: 5
2: 70
3: 120
4: 340
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510
1078062603_1078062610 26 Left 1078062603 11:8057724-8057746 CCCCAATAAAACTTGTTTAACCT 0: 1
1: 9
2: 85
3: 152
4: 355
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510
1078062604_1078062610 25 Left 1078062604 11:8057725-8057747 CCCAATAAAACTTGTTTAACCTT 0: 1
1: 6
2: 74
3: 125
4: 411
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510
1078062602_1078062610 27 Left 1078062602 11:8057723-8057745 CCCCCAATAAAACTTGTTTAACC 0: 1
1: 54
2: 102
3: 100
4: 217
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510
1078062607_1078062610 6 Left 1078062607 11:8057744-8057766 CCTTAAACGAGGCCTGTTAAGAA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1078062610 11:8057773-8057795 CATTATTTTGTCATGCTTTAAGG 0: 38
1: 70
2: 77
3: 122
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078062610 Original CRISPR CATTATTTTGTCATGCTTTA AGG Intronic