ID: 1078062611

View in Genome Browser
Species Human (GRCh38)
Location 11:8057779-8057801
Sequence TTTGTCATGCTTTAAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 61, 1: 94, 2: 97, 3: 78, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078062607_1078062611 12 Left 1078062607 11:8057744-8057766 CCTTAAACGAGGCCTGTTAAGAA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1078062611 11:8057779-8057801 TTTGTCATGCTTTAAGGCCCAGG 0: 61
1: 94
2: 97
3: 78
4: 219
1078062605_1078062611 30 Left 1078062605 11:8057726-8057748 CCAATAAAACTTGTTTAACCTTA 0: 1
1: 5
2: 70
3: 120
4: 340
Right 1078062611 11:8057779-8057801 TTTGTCATGCTTTAAGGCCCAGG 0: 61
1: 94
2: 97
3: 78
4: 219
1078062608_1078062611 0 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062611 11:8057779-8057801 TTTGTCATGCTTTAAGGCCCAGG 0: 61
1: 94
2: 97
3: 78
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078062611 Original CRISPR TTTGTCATGCTTTAAGGCCC AGG Intronic