ID: 1078062612

View in Genome Browser
Species Human (GRCh38)
Location 11:8057784-8057806
Sequence CATGCTTTAAGGCCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 61, 1: 112, 2: 77, 3: 69, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078062608_1078062612 5 Left 1078062608 11:8057756-8057778 CCTGTTAAGAATTCCTTCATTAT 0: 70
1: 101
2: 99
3: 77
4: 240
Right 1078062612 11:8057784-8057806 CATGCTTTAAGGCCCAGGAAAGG 0: 61
1: 112
2: 77
3: 69
4: 175
1078062609_1078062612 -8 Left 1078062609 11:8057769-8057791 CCTTCATTATTTTGTCATGCTTT 0: 34
1: 63
2: 71
3: 136
4: 671
Right 1078062612 11:8057784-8057806 CATGCTTTAAGGCCCAGGAAAGG 0: 61
1: 112
2: 77
3: 69
4: 175
1078062607_1078062612 17 Left 1078062607 11:8057744-8057766 CCTTAAACGAGGCCTGTTAAGAA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1078062612 11:8057784-8057806 CATGCTTTAAGGCCCAGGAAAGG 0: 61
1: 112
2: 77
3: 69
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078062612 Original CRISPR CATGCTTTAAGGCCCAGGAA AGG Intronic