ID: 1078065724

View in Genome Browser
Species Human (GRCh38)
Location 11:8078100-8078122
Sequence ATCAGTTCACCCAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078065724_1078065736 6 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065736 11:8078129-8078151 TGGGAGAGGGGGTGGCCCTGGGG 0: 1
1: 1
2: 6
3: 90
4: 762
1078065724_1078065733 -2 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065733 11:8078121-8078143 ATTCTGCTTGGGAGAGGGGGTGG 0: 1
1: 0
2: 3
3: 39
4: 368
1078065724_1078065734 4 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065734 11:8078127-8078149 CTTGGGAGAGGGGGTGGCCCTGG 0: 1
1: 0
2: 6
3: 64
4: 548
1078065724_1078065731 -6 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065731 11:8078117-8078139 ACTGATTCTGCTTGGGAGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 211
1078065724_1078065740 23 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065740 11:8078146-8078168 CTGGGGTCCTCAAGCTCAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 211
1078065724_1078065730 -7 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065730 11:8078116-8078138 AACTGATTCTGCTTGGGAGAGGG 0: 1
1: 0
2: 2
3: 15
4: 255
1078065724_1078065735 5 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065735 11:8078128-8078150 TTGGGAGAGGGGGTGGCCCTGGG 0: 1
1: 0
2: 8
3: 41
4: 443
1078065724_1078065737 20 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065737 11:8078143-8078165 GCCCTGGGGTCCTCAAGCTCAGG 0: 1
1: 0
2: 2
3: 30
4: 230
1078065724_1078065729 -8 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065729 11:8078115-8078137 GAACTGATTCTGCTTGGGAGAGG 0: 1
1: 0
2: 2
3: 13
4: 176
1078065724_1078065732 -5 Left 1078065724 11:8078100-8078122 CCTTCTTCCCTGGGTGAACTGAT 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1078065732 11:8078118-8078140 CTGATTCTGCTTGGGAGAGGGGG 0: 1
1: 1
2: 0
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078065724 Original CRISPR ATCAGTTCACCCAGGGAAGA AGG (reversed) Intronic
900188162 1:1342538-1342560 CTCAGGGCACCCAGGGAACAGGG + Intronic
900825360 1:4921824-4921846 ACCAGTTCTCCCAGGCTAGAGGG + Intergenic
902503116 1:16923460-16923482 TCCAGTTCTCCCAGGGTAGAAGG + Intronic
906444771 1:45886683-45886705 ATCTGTTTACCCAGGCTAGAAGG + Intronic
908362664 1:63384180-63384202 ATCATCTCACCCAGGTAAAATGG - Intronic
909103642 1:71381557-71381579 ATCAGTTCACCCAGGAGATCTGG - Intergenic
911711881 1:101082998-101083020 AAAAGTTCATTCAGGGAAGATGG - Intergenic
912622807 1:111181076-111181098 ATCACTTCAACCCGGGAAGCGGG + Intronic
913300542 1:117365707-117365729 ACCAGTTCACCCAGGGAGACTGG - Intergenic
916042483 1:160973192-160973214 AAAAGTTCACCCAGAGAAGTCGG + Intergenic
916126548 1:161576565-161576587 ATCACTTCAGCCAGGGAGGAGGG - Intergenic
916136467 1:161658405-161658427 ATCACTTCAGCCAGGGAGGAGGG - Intronic
917380341 1:174399547-174399569 CTCAGATTACACAGGGAAGAAGG + Intronic
917529029 1:175816345-175816367 ATCAGTCCACCCTGGAAAGCGGG + Intergenic
918395020 1:184104715-184104737 ATCAGTTCAACCATTGTAGAAGG - Intergenic
920531363 1:206705113-206705135 AACAGTTCTCCCAGAGAAGGGGG - Intronic
922235684 1:223720968-223720990 CTCAGTTCCCCCAGGGAACTTGG + Intronic
924556127 1:245120204-245120226 ATCGGTGCACTCAGGGGAGAGGG - Intronic
1065536852 10:26723246-26723268 ATAAGTCCACTCAGTGAAGAAGG + Intronic
1065837952 10:29676213-29676235 ATCAGTACTGCCAGGGAAGAAGG - Intronic
1067090836 10:43265186-43265208 AACAGTTCACACAGAGCAGAGGG - Intronic
1067721275 10:48729418-48729440 ATCTGTTCCCCCAGGTATGATGG + Exonic
1068067360 10:52148698-52148720 ATGACTGCAACCAGGGAAGAAGG + Intronic
1074213487 10:111360728-111360750 ATCAGTTAAAGCAGGGAAGGAGG - Intergenic
1075853481 10:125607956-125607978 ATCATTTCATGCATGGAAGAAGG - Intronic
1075945973 10:126433359-126433381 GTCAGGTCCACCAGGGAAGAAGG + Intronic
1076273133 10:129174194-129174216 AGCAGGTCACCCAGGAAACATGG + Intergenic
1076545647 10:131244362-131244384 AGGAGTTCATCCAGGGGAGAGGG + Intronic
1076578871 10:131493560-131493582 ATCAGTTAACACAGAGAAGGTGG + Intergenic
1076677170 10:132153150-132153172 GTCAGATCTCCCAGGGCAGACGG - Intronic
1078065724 11:8078100-8078122 ATCAGTTCACCCAGGGAAGAAGG - Intronic
1079397866 11:20081451-20081473 ATCAGTCAAATCAGGGAAGATGG + Intronic
1081552811 11:44129871-44129893 AGAAGTTCAGCCAGTGAAGAAGG + Intronic
1083446147 11:62709079-62709101 AGCAGGTCACCGAGGGAAGCGGG - Exonic
1084094502 11:66902016-66902038 ATCAGTTCGCCCAGAGAACCAGG - Intronic
1084890348 11:72233643-72233665 ATCAGTGCAACCTGGGGAGAGGG - Exonic
1084973301 11:72782769-72782791 CTCAGTTCACACAGAGCAGATGG - Intronic
1088106643 11:106213931-106213953 ATCCTATCACCCAGGGTAGAGGG + Intergenic
1088331173 11:108653893-108653915 ATCACCTCACCCAGTTAAGATGG + Intergenic
1091306235 11:134538027-134538049 ACCACTTCACCCAGGGCACAGGG + Intergenic
1094165370 12:27437641-27437663 AACAGTTCACAAAGGGAAGGGGG + Intergenic
1096311886 12:50528651-50528673 ATGAGTTCACCCAGGAAAGAGGG + Intronic
1101727042 12:107396291-107396313 TTCAGTGCAGGCAGGGAAGAAGG - Intronic
1101900979 12:108790922-108790944 ATCACTTCCCCCATGGAGGAGGG + Intronic
1102022492 12:109693616-109693638 ATCAGCCCACCCAATGAAGAAGG + Intergenic
1102206354 12:111093598-111093620 TTCAGCTCACCCAGGGCAGCAGG + Intronic
1102620492 12:114190989-114191011 ATCAGTTCAGCCAGGCAACTTGG - Intergenic
1102969722 12:117156597-117156619 GTCAATTAACCCAGGGAGGAAGG + Intronic
1104658836 12:130594137-130594159 CTCACTTCACCAAGTGAAGATGG + Intronic
1105451104 13:20501143-20501165 ATGAGTACAGCCAAGGAAGAAGG - Intronic
1109501269 13:63238791-63238813 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1113208805 13:107950675-107950697 ATCATTTCACCCAGTTAAAATGG + Intergenic
1113482448 13:110631490-110631512 ATCAGAGCACCCAGCGCAGAAGG - Intronic
1115375500 14:32671028-32671050 TTCAATTCACTGAGGGAAGATGG + Intronic
1116021750 14:39469643-39469665 ATCTGTGCACTCAAGGAAGAAGG - Intergenic
1116330452 14:43590877-43590899 ATCAGTTCACACACTGAAGAAGG - Intergenic
1118332756 14:64826594-64826616 ATCAGTAAACCCAGGAAAAAAGG + Intronic
1120476851 14:84999155-84999177 ACCATGCCACCCAGGGAAGAAGG - Intergenic
1121742883 14:96266391-96266413 GACAGTTCACCCAGGAAGGATGG + Intronic
1124446537 15:29739411-29739433 ATTTGTTCTCCCAGGGAAGGAGG + Intronic
1126382301 15:48061589-48061611 ATCAGTAGCCCCAGGGAACATGG + Intergenic
1127160958 15:56185266-56185288 TTCACTTCAGCCAGGGAATATGG + Intronic
1131570721 15:93532557-93532579 ATCACTTCACCGTGGGTAGATGG + Intergenic
1136605933 16:31333748-31333770 ATCACCCCACCCAGGGGAGAAGG + Intergenic
1137546727 16:49409993-49410015 ATCCCTTGGCCCAGGGAAGATGG + Intergenic
1137626854 16:49914487-49914509 CTCATTTCACGCAGGGAAGTAGG - Intergenic
1138001134 16:53281077-53281099 ATGAGTTCACCTAAGGAAAAAGG - Intronic
1139293301 16:65877157-65877179 AGGAGTTCACCAAGGGGAGAAGG - Intergenic
1140298179 16:73728995-73729017 GTGTGTTCAGCCAGGGAAGAAGG + Intergenic
1141511340 16:84514231-84514253 CTCAGTTCCCCCAGGTAAAATGG + Intronic
1144342241 17:14319407-14319429 AACAGTGGACACAGGGAAGAGGG + Intronic
1145254071 17:21313365-21313387 ACACGTGCACCCAGGGAAGAAGG - Intronic
1145963370 17:28900693-28900715 ATCAGTTCAGTCAGTGCAGATGG + Intronic
1146457011 17:33016274-33016296 AGCAGTTCACCCTGTGAAGCAGG - Intronic
1146596669 17:34175448-34175470 AGCCCTTCTCCCAGGGAAGAAGG + Intergenic
1146977474 17:37127177-37127199 TTCTGTTCACCCATGAAAGAAGG + Intronic
1147296395 17:39486349-39486371 ATCACTTGAGCCAGGGAAGGAGG - Intronic
1147417329 17:40302438-40302460 ATCACTTCAACCTGGGAAGCGGG - Exonic
1148020777 17:44551943-44551965 CTAAGATCACCTAGGGAAGATGG - Intergenic
1150236011 17:63593191-63593213 ATTGGTTTTCCCAGGGAAGAGGG + Exonic
1150824539 17:68463069-68463091 ATCAGTCACCCCTGGGAAGAAGG + Intergenic
1153555689 18:6310955-6310977 AACAGGTCCCCCAAGGAAGAAGG + Intronic
1154983271 18:21522117-21522139 ATTAGTTATCACAGGGAAGAGGG + Intronic
1157528337 18:48401932-48401954 ATCATTGCATCCTGGGAAGAAGG - Intronic
1158574213 18:58622626-58622648 ATCAGTTAACTCAAGGAAGTGGG - Intronic
1159160903 18:64642577-64642599 ATCTGTTCACACAGTGAGGAGGG + Intergenic
1165611170 19:37154680-37154702 ATCAGTTTATCCAGGCATGAAGG + Intronic
1165700433 19:37933155-37933177 ATGAGGTCACACAGGGAAAATGG - Intronic
927430551 2:23023221-23023243 ATCTTATCTCCCAGGGAAGATGG - Intergenic
927539760 2:23898463-23898485 ATCAGTTCAGTCTGGAAAGACGG - Intronic
928538804 2:32264956-32264978 ACCAGTTCAGAAAGGGAAGATGG + Intronic
931181921 2:59910137-59910159 ATCATTTCACCAATGGAAGAGGG - Intergenic
931413103 2:62053715-62053737 ACCAGTTACCCCAGAGAAGAAGG + Intronic
931908874 2:66872463-66872485 TTGAGTTCACCCAGGGAAATAGG - Intergenic
932977757 2:76624988-76625010 TTCAGTTCACCCAGGGCACAGGG - Intergenic
935461473 2:103340885-103340907 ATCGGTTGACTCAGTGAAGATGG - Intergenic
937440150 2:121908419-121908441 AACAGCTCACCCTGAGAAGAAGG - Intergenic
937774483 2:125759708-125759730 ATCAGATCTCCCAGGGTTGAGGG - Intergenic
938101421 2:128500330-128500352 CTCAGTCCACACAGGGAAGAGGG + Intergenic
939360974 2:141172213-141172235 ATCAGTTCATCCAGGGCAGGAGG + Intronic
940149713 2:150585987-150586009 ATCAGTTCAACCAGGAAGAAGGG - Intergenic
940265618 2:151832190-151832212 ATCTGATCACCCAGGAAAGTAGG - Intergenic
941087189 2:161131516-161131538 TTCCTTTCTCCCAGGGAAGAAGG + Intergenic
943025082 2:182617625-182617647 TTCAGTTCACCCAGTGCAGATGG + Intergenic
945493733 2:210484835-210484857 ATCAGTTTTTCCAGGGAAGAAGG - Intronic
948374350 2:237511627-237511649 ACCAGATGTCCCAGGGAAGAAGG - Intronic
1169422462 20:5471388-5471410 ATCAGGCCACCCAGGGACAAAGG + Intergenic
1169460852 20:5793791-5793813 ATCACTTGAACCAGGGACGAAGG - Intronic
1170429848 20:16265906-16265928 ATGAGTACTGCCAGGGAAGAAGG + Intergenic
1170430716 20:16273837-16273859 ATCAGACCAACCAGAGAAGACGG + Intronic
1170462095 20:16586993-16587015 ATCAAGTCACTGAGGGAAGATGG - Intergenic
1170604797 20:17867779-17867801 ATCATCTCATCCAGGGATGAGGG + Intergenic
1171446525 20:25207985-25208007 ATCAGGGAACCAAGGGAAGAGGG - Intronic
1172344904 20:34190437-34190459 ATGAGATCACCCAGGGAAAATGG - Intergenic
1173551852 20:43938024-43938046 TTCACTTGACCCAGGGAGGATGG - Intronic
1174596179 20:51685474-51685496 ATCACTTCAACCTGGGAAGGTGG + Intronic
1174930457 20:54808291-54808313 TTCAGAACACCCAGGGAAGATGG - Intergenic
1176514931 21:7776975-7776997 ATCAGTATTGCCAGGGAAGAAGG - Intergenic
1178648986 21:34407034-34407056 ATCAGTATTGCCAGGGAAGAAGG - Intronic
1179241354 21:39595957-39595979 ATCAGTGCACTGAGGGAAAAGGG - Intronic
1182797307 22:33000359-33000381 ATGAGTTCTCCCAGCAAAGACGG + Intronic
1183996234 22:41634828-41634850 ATCAGTTCACCCAGGCGCGGTGG - Intronic
1184158357 22:42683669-42683691 ATCAGTGCAGCCAGGGGTGAGGG + Intergenic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949743999 3:7267598-7267620 ATGAGTATAACCAGGGAAGAAGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950369056 3:12512188-12512210 TTCACTCCACCCAGGGAAGTTGG - Intronic
951422803 3:22507974-22507996 ATAAGATCACTGAGGGAAGAAGG + Intergenic
953695223 3:45153012-45153034 ATCTGTTCACTCAGGAGAGAAGG - Intergenic
953882084 3:46695855-46695877 ATGAGGTCACCCAGGGAATGGGG - Intergenic
955143481 3:56292720-56292742 CTCTGTTCCCCCAGGTAAGATGG + Intronic
956536440 3:70282070-70282092 ACAAGTACAGCCAGGGAAGAAGG + Intergenic
957751088 3:84416968-84416990 ATCATATCACTCAGGTAAGATGG + Intergenic
959862696 3:111234189-111234211 ATTTGTTCAGCCAGGAAAGATGG + Intronic
961332321 3:126149836-126149858 TTCTCTCCACCCAGGGAAGAAGG + Intronic
961949085 3:130727729-130727751 ATCAGTACATTCAGGGAAAAGGG + Intronic
964137643 3:153363270-153363292 ATGAGTACTGCCAGGGAAGAAGG + Intergenic
964910533 3:161775160-161775182 ATCATTCCACCCTGGGAAGGAGG - Intergenic
965827605 3:172746419-172746441 ATGAGTTCACCTAGGGAAAGGGG + Intergenic
966110607 3:176396602-176396624 ATGAGTACTGCCAGGGAAGAAGG - Intergenic
966177574 3:177155761-177155783 ATCCGTGCACTCCGGGAAGAGGG + Intronic
966545280 3:181139196-181139218 ATTAGTTAACCAAGTGAAGAAGG - Intergenic
966973554 3:185066502-185066524 ATCAGCTCTCTCTGGGAAGAGGG - Intergenic
972048595 4:34700323-34700345 ATCAGTTCTCTCAAGAAAGATGG + Intergenic
974003597 4:56534480-56534502 ATGACCTCACCCAGGGAATAAGG - Intronic
975126733 4:70790943-70790965 ATCAGTCTACCTAGGAAAGATGG + Intronic
980023959 4:127742562-127742584 ATGAGTACTGCCAGGGAAGAAGG - Intronic
980146553 4:128992602-128992624 ATTATTTCACCCATGCAAGAAGG - Intronic
983152437 4:164301386-164301408 ATCAGTTTACACAAGGAACACGG + Intronic
983198085 4:164830426-164830448 ATGAGTTTACACAGGTAAGAGGG + Intergenic
983996139 4:174184729-174184751 ATGAGTTCCCCCAAGGAACATGG + Intergenic
984992430 4:185394170-185394192 ATCACTTGAACCCGGGAAGACGG + Intronic
986815069 5:11400274-11400296 AACATTTCACCCAGGGAAACAGG + Intronic
988921589 5:35947324-35947346 ATCAGTGGAGCCAGGGAAGGCGG - Intergenic
991294263 5:65064200-65064222 ATGAGTTCACCAAGGGAGTAAGG - Intergenic
994000058 5:94768688-94768710 ATCATTCCACCCAGTTAAGATGG + Intronic
996038245 5:118782367-118782389 ATAAGTCCTGCCAGGGAAGAAGG - Intergenic
997851054 5:137332924-137332946 ATGAGGTTACCCAGGGAAAATGG + Intronic
999605773 5:153314229-153314251 ATCAGTTCTCCCACGGACAATGG - Intergenic
1002864400 6:1108179-1108201 GTCAGTTCACACATGGAACACGG - Intergenic
1002905186 6:1442625-1442647 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1004345298 6:14843745-14843767 GTCAGTTCACTAAGTGAAGATGG - Intergenic
1005298470 6:24448973-24448995 ATTATGACACCCAGGGAAGAAGG + Intronic
1007606158 6:43119587-43119609 CCCTGATCACCCAGGGAAGATGG - Intronic
1007816531 6:44529122-44529144 ACCTGTTCAACCAGGGCAGATGG + Intergenic
1010989910 6:82469082-82469104 ATGAGTACTGCCAGGGAAGAAGG - Intergenic
1014554806 6:122832755-122832777 ATCTGTTCTCCCTGGGCAGACGG - Intergenic
1015309318 6:131748523-131748545 ATCAGTTCATCCAGGGACACAGG + Intergenic
1015394694 6:132720789-132720811 ATCACTTGAACCAGGGATGAAGG + Intergenic
1016009097 6:139120040-139120062 ATGAGTACTGCCAGGGAAGAAGG - Intergenic
1018197201 6:161365870-161365892 GCCAGTTCACTCAGGGGAGAGGG + Intronic
1022250774 7:28605854-28605876 ATCAGTTGAGCCTGGGAAGGGGG + Intronic
1022628618 7:32064138-32064160 AGGAGATGACCCAGGGAAGAGGG - Intronic
1023116218 7:36865061-36865083 CTCATTTGACCCATGGAAGATGG - Intronic
1024349285 7:48347398-48347420 ATTACTCCACCCAGGGAGGAGGG - Intronic
1024961252 7:54979216-54979238 ATGAGAACACCAAGGGAAGAAGG - Intergenic
1026055572 7:66980789-66980811 ATCAGTAGTGCCAGGGAAGAAGG - Intergenic
1026200583 7:68211233-68211255 AGCAGATAATCCAGGGAAGAGGG + Intergenic
1026722121 7:72841030-72841052 ATCAGTAGTGCCAGGGAAGAAGG + Intergenic
1027483104 7:78724057-78724079 ATGAGTACTGCCAGGGAAGAAGG + Intronic
1028925452 7:96352549-96352571 ATCATTTCAAACAGGCAAGAAGG + Intergenic
1034193053 7:149225612-149225634 TCCAGTTCTCCCAGGGCAGAGGG + Exonic
1035920206 8:3668255-3668277 ATGAGTTCAGCCTGCGAAGATGG + Intronic
1039172939 8:34769321-34769343 ATCTGTTGAGCCAGGGAAAATGG - Intergenic
1040934270 8:52766669-52766691 ATTACTTCTCCCAGAGAAGAAGG - Intergenic
1041026195 8:53689248-53689270 CTCACTTCACCCAGGAGAGAGGG - Intergenic
1041290451 8:56303226-56303248 ATCACTTGAACCAGGGAAGGCGG + Intronic
1041725254 8:61012064-61012086 ATCCGCTCACCCAGGGATGCTGG + Intergenic
1045495451 8:102704163-102704185 ATGAGTACTGCCAGGGAAGAAGG - Intergenic
1045684992 8:104702696-104702718 CCCAGTTCAACCAGGGAAGTTGG - Intronic
1045797153 8:106059671-106059693 ATAAATTCAATCAGGGAAGAAGG + Intergenic
1047548238 8:125840237-125840259 ATCAGTTCACACAGATGAGAAGG + Intergenic
1048250689 8:132864497-132864519 ATCAATTCACCCTGGGGAGTGGG - Intergenic
1048927229 8:139281904-139281926 ATGGATTCACACAGGGAAGAAGG + Intergenic
1049010406 8:139883625-139883647 CTTAGTACACCCAGGGGAGAGGG + Intronic
1050675005 9:8042199-8042221 ATCAGTTCACCCATTGTGGAAGG - Intergenic
1051696155 9:19769770-19769792 ATCTGTCCACCCAGAAAAGATGG + Intronic
1052330316 9:27260707-27260729 ATCAGTTCATCTAGGGAGAAGGG + Intergenic
1052485880 9:29099684-29099706 ATCATTTCACCCAGTTAATATGG + Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1055136219 9:72832039-72832061 ATCACTTCAGCCTGGGAAGTTGG - Intronic
1055416401 9:76088651-76088673 ATCAGTTCATCCGAGTAAGATGG - Intronic
1057127026 9:92625007-92625029 AACAGTTAACCCTGGGAGGAAGG + Intronic
1057214910 9:93222508-93222530 ATGAGTGCAGCCAGGGAAGGAGG - Intronic
1057313779 9:93956668-93956690 AACAGTTCCTCCAGGCAAGAGGG + Intergenic
1058457071 9:105147588-105147610 ATCAGGTAACCAAGGGCAGAGGG - Intergenic
1061925604 9:133804742-133804764 ATCAGCTCACCCACAGATGAAGG + Intronic
1062085451 9:134645804-134645826 ATCAGCTCTCCCCGGGGAGAAGG + Intronic
1203769550 EBV:41942-41964 ATCAGGTTAACAAGGGAAGAAGG - Intergenic
1185517991 X:715345-715367 CTCAGTCCATCCAGGGAGGAGGG - Intergenic
1185518033 X:715501-715523 CTCAGTCCATCCAGGGAGGAGGG - Intergenic
1186699036 X:12069655-12069677 ATGAGCTCACCTAAGGAAGAGGG + Intergenic
1187106027 X:16242838-16242860 ATCATTTCACCCAGTTAAAATGG - Intergenic
1188000211 X:24973567-24973589 CTCAGGTAACCCTGGGAAGAGGG - Intronic
1190260728 X:48795257-48795279 AGCAGTTCACCCAGGTGAGTGGG - Intergenic
1197050050 X:122046760-122046782 AACAGTTCACACAGGGAATAGGG + Intergenic
1201235251 Y:11903528-11903550 ATCTTCTGACCCAGGGAAGAAGG + Intergenic