ID: 1078066888

View in Genome Browser
Species Human (GRCh38)
Location 11:8084562-8084584
Sequence GAGGACAAGGGCACTGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078066888_1078066898 16 Left 1078066888 11:8084562-8084584 CCGTCCTCAGTGCCCTTGTCCTC 0: 1
1: 0
2: 2
3: 75
4: 503
Right 1078066898 11:8084601-8084623 TGCCTGGTGTTTCTCTCACTTGG 0: 1
1: 0
2: 1
3: 22
4: 203
1078066888_1078066895 0 Left 1078066888 11:8084562-8084584 CCGTCCTCAGTGCCCTTGTCCTC 0: 1
1: 0
2: 2
3: 75
4: 503
Right 1078066895 11:8084585-8084607 ATGGTCCTGAGGCCATTGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078066888 Original CRISPR GAGGACAAGGGCACTGAGGA CGG (reversed) Intronic
900176807 1:1294717-1294739 GTGGACAGCGTCACTGAGGAGGG - Exonic
900690447 1:3977516-3977538 GAAGGCATGGGCACTGAGGTGGG + Intergenic
901050627 1:6424340-6424362 GAGGACAACGGCCCTGAGGCAGG - Intronic
901572095 1:10169208-10169230 CAGGACAAGGGTAGTGAGGAAGG + Intronic
901686317 1:10945562-10945584 AAGAGCAAGGGCCCTGAGGAGGG - Intergenic
902410050 1:16207105-16207127 GAGGCCGAGGGCGCAGAGGAGGG - Exonic
902882093 1:19378820-19378842 GAGAACAAGGGCTCTGATGCGGG + Intronic
903070405 1:20724343-20724365 GTGGACAAGGGAACTGGGTATGG - Intronic
903193223 1:21668284-21668306 GAGGGAAGGGGCACTGAGGCAGG - Intronic
903464968 1:23545692-23545714 AAGGACACGGGGACTCAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904419162 1:30380290-30380312 CAGGAGCTGGGCACTGAGGAAGG + Intergenic
904809112 1:33151752-33151774 GAGGTCAAAGGCATTCAGGAAGG + Intronic
905649509 1:39646971-39646993 CAGGACAAGGACACTGGGGGTGG + Intergenic
906532497 1:46531777-46531799 GAGGGCATGGTCACTGAGCAGGG - Intergenic
906644338 1:47463049-47463071 GAGGACAAGGGGATTATGGAAGG + Intergenic
906796209 1:48698177-48698199 TAGGCCATGGGCACTGAGGATGG + Intronic
910384446 1:86665686-86665708 AAGGAAAGGAGCACTGAGGAAGG - Intergenic
911102370 1:94104753-94104775 GAGGAGGAGGGCTCTGAGAAGGG + Intronic
912519768 1:110237376-110237398 GAGGAAAGTGGGACTGAGGAAGG - Intronic
912587886 1:110783438-110783460 CAGGAAAAGGGCAGTGATGAAGG - Intergenic
913129896 1:115829613-115829635 GAGGACAAGTCCACTGAGCAGGG + Intergenic
914814396 1:151052891-151052913 GAGGAGAAGGGCAGGGAGGTAGG + Exonic
915109198 1:153552458-153552480 GAGGACAAGGGCAAGGAGCCGGG - Intergenic
915462217 1:156076917-156076939 GAGGAGAAGAGCACGGAGGTGGG + Exonic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
917337824 1:173943441-173943463 GAGAACACGGGAACTGAGTATGG - Exonic
917397049 1:174604460-174604482 AAGGAAAAAGGCACTGAAGAGGG - Intronic
918860566 1:189820755-189820777 GAAGACAAGGGAACTGAGGTGGG + Intergenic
919052699 1:192531278-192531300 AAGTACAAAGGCTCTGAGGAAGG + Intergenic
919767799 1:201138539-201138561 GAGCAGAAGGGCAGTTAGGAGGG + Intronic
920008827 1:202853090-202853112 GTGGACAGGGGCATGGAGGAAGG - Intergenic
920852238 1:209635931-209635953 CTGGACAAAGGCTCTGAGGAGGG - Intronic
922144399 1:222924919-222924941 GAAGACAAGGGCATGGGGGAGGG - Intronic
922323881 1:224510863-224510885 GAGGACAAAGCCAGGGAGGAAGG - Intronic
922453298 1:225754021-225754043 GAGAAAAAGGGCATGGAGGAGGG - Intergenic
922617838 1:226973648-226973670 GAGGACAGGGGGCCTGGGGAGGG - Intronic
922745597 1:228041684-228041706 GAGGACAAGGACACATAGCAAGG - Intronic
923299574 1:232629566-232629588 GGCGACACAGGCACTGAGGAGGG - Intergenic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923753258 1:236766589-236766611 GAGGACTTGGGGACTGAGGGGGG + Intergenic
924475804 1:244381019-244381041 GAGGTCAAGGTCACTGGGAAAGG + Intronic
924575518 1:245277432-245277454 AAGCCCCAGGGCACTGAGGAAGG - Intronic
924588663 1:245382215-245382237 GAGGAAAAAGGTACTGGGGAGGG - Intronic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063280518 10:4624830-4624852 GGGGACAGGGGCACAGAGGGAGG - Intergenic
1063614115 10:7587654-7587676 GATGAAAAGGGCTCTGAGCAGGG + Intronic
1064194437 10:13233804-13233826 CAGGACAAGGGCACAGAGTGAGG + Intronic
1065390616 10:25176994-25177016 GAGGAAAAGGCCACCGAGGAAGG - Intronic
1067848317 10:49739793-49739815 GAGGACCAGGGCATTGGGGCTGG + Exonic
1067964146 10:50889792-50889814 GAGGATATGGGAACTGAGCAGGG + Intergenic
1069382596 10:67856135-67856157 GAGGGCAAGGGTCCTGAGGCTGG - Intergenic
1069713101 10:70502768-70502790 GTGGGCATGGGCACTGGGGACGG - Intronic
1070673369 10:78393892-78393914 GATGACATGGGCATTGAGGTTGG + Intergenic
1070935452 10:80290974-80290996 GAGGAAAAGGCCACTGGGAAGGG + Intergenic
1073982775 10:109173803-109173825 GATGACGAGGACAATGAGGAGGG - Intergenic
1074137996 10:110644347-110644369 AAGGACAAGGGGACTGGGCACGG + Intergenic
1074969913 10:118527704-118527726 AAGGACTTGGGCACTCAGGAGGG - Intergenic
1074971034 10:118538985-118539007 GAGAATAAGAGCACTGAGCAGGG - Intergenic
1075024898 10:118977287-118977309 GAGAACAAGGCCTCTGAGCATGG - Intergenic
1075058450 10:119237687-119237709 GAGGGGGAGGGAACTGAGGAGGG + Intronic
1075079195 10:119371311-119371333 GAGGACACAGGCAGTGAGGGCGG - Intronic
1075486094 10:122823063-122823085 GAGGACAAGAGCTCTGGGGATGG + Intergenic
1075679746 10:124323568-124323590 GAGGAAAGAGGCTCTGAGGAGGG + Intergenic
1076310974 10:129507316-129507338 GAGGACAAGGCCTCTGGGGCAGG + Intronic
1076387662 10:130068948-130068970 GAGGAAAAGGACACAGAGAAAGG + Intergenic
1076512956 10:131025308-131025330 GAGGACATGGGCCAGGAGGAAGG + Intergenic
1076583977 10:131532972-131532994 GAGCACAAGGGCCCTGGGAATGG - Intergenic
1076798213 10:132808964-132808986 GAGGACCAGGGCACAGGGGCGGG + Intronic
1077337355 11:2011335-2011357 GAGGACAAGGGCTTGGAGGTGGG + Intergenic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077606446 11:3615992-3616014 GAAGAGAAGAGCAGTGAGGATGG + Intergenic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1078390451 11:10931685-10931707 GAGGCCAAGGGGACAGGGGAGGG + Intergenic
1078421062 11:11213418-11213440 GATGACAAGGGGACTGTGGAGGG - Intergenic
1079901987 11:26198130-26198152 GAGGACTAGGGGATTGAGGATGG + Intergenic
1081747148 11:45481384-45481406 GAGGTAAAGGGCACTGGGAAGGG - Intergenic
1081875036 11:46402734-46402756 GAATTCAAGGGCACTGTGGAGGG - Intronic
1083735456 11:64677713-64677735 GGGAACAAGGGCTGTGAGGAGGG + Intronic
1084116022 11:67043371-67043393 GGTGCCACGGGCACTGAGGACGG + Intronic
1084191503 11:67501351-67501373 GATGACCTGGGCACTGAGGCAGG + Intronic
1084278103 11:68066734-68066756 GAGGACTAGGGCTGTGAGCAGGG - Intronic
1084501139 11:69536122-69536144 GAGGACTAGGGTGCTGGGGATGG - Intergenic
1084617820 11:70248026-70248048 GAGTACAAGGGCCCTGGGGCAGG + Intergenic
1084731342 11:71075611-71075633 GTGGAGCTGGGCACTGAGGATGG - Intronic
1084779672 11:71399991-71400013 GGAGACATGGGCACAGAGGAGGG + Intergenic
1085046475 11:73356566-73356588 CAGCACAAGGGCATTGAGGGTGG + Intronic
1085342372 11:75741464-75741486 GAGGACATGGCCAATGTGGATGG - Intergenic
1085384166 11:76147198-76147220 GAGGACAGGAGCACTTGGGAAGG + Intergenic
1085556886 11:77431469-77431491 GAGGAAAAGACCACTGAAGAGGG - Intronic
1086160937 11:83720988-83721010 GAGGAGCTGGGTACTGAGGAAGG + Intronic
1087007260 11:93482308-93482330 GAGGGCATGGGCACTGGGGAAGG + Intronic
1087950945 11:104219656-104219678 GCTGAAAAGGGCACTGAAGAGGG - Intergenic
1088311693 11:108467236-108467258 GAGGAAAGGAGCTCTGAGGAAGG + Intronic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088650081 11:111949785-111949807 GAGGACAAGGGCAGAGGTGATGG - Intronic
1088675505 11:112188624-112188646 GAGGACAAGGGCAGAGATGATGG - Intronic
1088745421 11:112800610-112800632 CAGGAAAAGGGCCCTGGGGAGGG - Intergenic
1089049969 11:115537506-115537528 ACGGACAAGGGCCCTGAGGCAGG + Intergenic
1089181088 11:116583328-116583350 GAGGACAAGGGATGTGAGGAGGG + Intergenic
1202820339 11_KI270721v1_random:66517-66539 GAGGACAAGGGCTTGGAGGTGGG + Intergenic
1091691218 12:2598780-2598802 GGGGACAAGGACACAGGGGAAGG - Intronic
1091692090 12:2604254-2604276 GAGGAGAAGGGGACTGAGACAGG + Intronic
1092215517 12:6679062-6679084 GAGGGCAGGGACACTGAGGCAGG + Exonic
1093692681 12:22125485-22125507 GAGAACTAGGGCAGTGGGGAAGG + Intronic
1095791274 12:46170185-46170207 GAGGACAAAGTCACTGAAGGAGG + Intergenic
1095882286 12:47150693-47150715 AAGTACAAAGGCACTGAGGTAGG + Intronic
1096072408 12:48782634-48782656 GAGGCCCAGGCCGCTGAGGACGG + Exonic
1096109194 12:49019108-49019130 AAGGACAGGGGCGCTGAGGGTGG + Exonic
1096231594 12:49899939-49899961 GAGGATATGGGAAATGAGGAAGG + Intronic
1096499751 12:52057501-52057523 GAGGACAAGGGCAGAGAGGCAGG - Exonic
1096578585 12:52570014-52570036 TGAGACAAGGGCACTGGGGAAGG + Intronic
1096699446 12:53372425-53372447 GAGGCTCAGGGAACTGAGGAGGG - Intergenic
1097072021 12:56362012-56362034 CAGGACAAGGGGTCTGAGGAGGG + Exonic
1098249973 12:68559444-68559466 AAGGACAAAGGCCCTGAGGTAGG + Intergenic
1100001052 12:89835572-89835594 GAGGGAAATGGCACTGAGCAGGG + Intergenic
1100214747 12:92435809-92435831 AGGGCCAAGGGCACTGAGGGAGG - Intergenic
1100959566 12:99947209-99947231 GAAGACAAAAGCACTGGGGAGGG + Intronic
1101406420 12:104433046-104433068 AATGACAAGGGAACTGAGAAGGG + Intergenic
1101874938 12:108591740-108591762 GAGGAGAAGGGCAGCCAGGAGGG - Exonic
1102130367 12:110523972-110523994 GAGAACAGAGGCACAGAGGATGG - Intronic
1102202562 12:111067767-111067789 GAGAACAAGGGGACAGAGGGAGG + Intronic
1102278684 12:111601145-111601167 GAGGGCAAAGGCTCTGAGGGGGG + Intergenic
1102999408 12:117374017-117374039 CAGGACAAGGGGGCTGAGAAGGG + Intronic
1103224197 12:119272716-119272738 GAGGACAAGGACACAAAGAATGG + Intergenic
1103935624 12:124475015-124475037 GAGGACAGAGGCCCTGAGGATGG - Intronic
1103956174 12:124578084-124578106 GAGGAAATGGGCGCTGTGGAGGG + Intergenic
1104044388 12:125151564-125151586 GAGGATAAGGGCTCTGAGGCTGG + Intergenic
1104337902 12:127918035-127918057 AAGGACAAGGGCAGGCAGGAGGG - Intergenic
1104714397 12:131006692-131006714 GAGGATGAGGGAAATGAGGAGGG + Intronic
1104957729 12:132474630-132474652 GAGGGGAAGGGCACCGCGGAGGG - Intergenic
1105839785 13:24244099-24244121 CAGGCCAAGGGCACCAAGGAAGG - Intronic
1106554199 13:30796149-30796171 GATGGCAGGGGCACAGAGGAAGG + Intergenic
1106659065 13:31779370-31779392 GAAGACATAAGCACTGAGGAGGG - Intronic
1107655837 13:42591431-42591453 GAGGACAGGAGCACTGGGGGAGG - Intronic
1107689021 13:42933557-42933579 GATGACAATGGCAAAGAGGATGG - Intronic
1107944151 13:45402274-45402296 GGGGACAAGAGGACTGTGGAAGG - Exonic
1108549042 13:51524793-51524815 GAGGAAGAGGGCAATGATGAGGG + Intergenic
1109220461 13:59636190-59636212 AAGGAAAAGGGTACTGAAGATGG + Intergenic
1110480538 13:75969220-75969242 GAGGACAAAGAGACTGAAGAAGG + Intergenic
1110894264 13:80729423-80729445 GGGGTGAAGGGCAGTGAGGAAGG + Intergenic
1111995159 13:95158377-95158399 CAGCACAAGGGCACTGGAGATGG + Intronic
1113288988 13:108884756-108884778 GATGAGAAAGGCACTGAGGCGGG + Intronic
1113289028 13:108885043-108885065 GATGAGAAAGGCACTGAGGTGGG + Intronic
1113426621 13:110213681-110213703 GAGGACGAGGGCAAGGAGAAAGG + Intronic
1113575378 13:111391606-111391628 AAGCACAAGGGCAGTGAGGCTGG - Intergenic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113731604 13:112645477-112645499 GATGGCGAGGACACTGAGGATGG + Intergenic
1113839609 13:113351254-113351276 GAGGAGACGGGCATTGAGGAGGG - Intronic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114524554 14:23359726-23359748 GAGGGCGGGGGCACTGATGAGGG - Exonic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117329403 14:54697536-54697558 CAGGACGGGGGCGCTGAGGAAGG + Intronic
1118867220 14:69712971-69712993 GAAGACAAGGGCACTGCTGTGGG - Exonic
1118870130 14:69734398-69734420 GAGGGCAAGGGCACAGGGGAAGG + Intronic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1119442670 14:74638786-74638808 GAGGACAGGGCCACTTGGGATGG - Intergenic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1121267462 14:92613694-92613716 AAGGACAGAGGCACTGAGGGGGG + Intronic
1121278433 14:92683314-92683336 GAGATCAAGGGCCCAGAGGAGGG - Intronic
1121607675 14:95253182-95253204 AAGGACAAAGGAACTGAGGAAGG + Intronic
1122114795 14:99522287-99522309 GAGGACAAGGGCCCTGGGCATGG + Intronic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122419589 14:101567062-101567084 GGTGACAAGGGCAATGAAGAAGG + Intergenic
1122626360 14:103087314-103087336 GAGCACAAGGGCCTCGAGGAAGG - Intergenic
1122687773 14:103518206-103518228 GAGGCTGAGGGCAGTGAGGAAGG - Intergenic
1122718512 14:103709105-103709127 GAGGACATGTGCCCTGGGGAGGG + Intronic
1122939674 14:104975669-104975691 GCAGACAAGGACACTGAGGCTGG - Intronic
1122952140 14:105050897-105050919 GGGGACATGGGCACTGTGGCTGG + Exonic
1122956834 14:105075117-105075139 GAGGCCCAGGGCCATGAGGAGGG - Intergenic
1124786574 15:32686986-32687008 GAAGTCAAAGGCACTAAGGAGGG + Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125794879 15:42396846-42396868 CAGCACCAGGTCACTGAGGATGG + Exonic
1126098923 15:45108106-45108128 GAGGACAATGGCACTGAACAGGG + Exonic
1126351987 15:47753409-47753431 GCTGACAAGGACACAGAGGATGG + Intronic
1127092148 15:55478065-55478087 CTGGACAGGGGCAGTGAGGAAGG - Intronic
1127548691 15:60015646-60015668 GAAGAAAAGGGCACTCAGGTTGG - Intronic
1128246261 15:66134711-66134733 GGGGAGAAGGGCGCTGAGGGAGG + Intronic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128765460 15:70248490-70248512 GAGGACAAAGGCTCTTAGGCAGG - Intergenic
1129276663 15:74450027-74450049 CAGGACAATGGCATTGACGAGGG + Exonic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1130559516 15:84947138-84947160 AAGGACACAGGCCCTGAGGATGG - Intergenic
1130884341 15:88080982-88081004 AAGGACAGGGGAACTGAGCATGG - Intronic
1131087011 15:89585200-89585222 GAGGAAAAGGGCACTGGGTTTGG + Intronic
1131265247 15:90911664-90911686 GAGGACAAGTGTCCTGGGGAGGG + Intronic
1132989907 16:2787190-2787212 GAGGAGGAGGGGGCTGAGGATGG - Intronic
1133049237 16:3107335-3107357 GAAAACAAGGGAACTGAGCAAGG - Intergenic
1133892971 16:9899037-9899059 GAGCACCAGGGCAAAGAGGAAGG - Intronic
1134514417 16:14875145-14875167 GAGAAAAACGGCAATGAGGAAGG + Exonic
1134692972 16:16203262-16203284 GGTGAGAAGGACACTGAGGAAGG - Intronic
1134702094 16:16273798-16273820 GAGAAAAACGGCAATGAGGAAGG + Exonic
1134969737 16:18520852-18520874 GAGAAAAACGGCAATGAGGAAGG - Exonic
1135341784 16:21654487-21654509 GGGGACAAGGGGACTAGGGAAGG - Intronic
1138198891 16:55074417-55074439 GAGGACAAGGGCCAGGAGGGTGG + Intergenic
1138432383 16:56977398-56977420 GTGGACAAGAGCCCTGTGGAAGG - Intronic
1138482537 16:57313137-57313159 AAGGGCAAGGGCATTGAGGGAGG + Intergenic
1138539098 16:57677710-57677732 GAGAACAAGGGCAGAGAGGGAGG - Intronic
1139547079 16:67654345-67654367 GAGGACCCGGCCACTGAGGGGGG + Exonic
1139917632 16:70438435-70438457 GAGAACTGGGCCACTGAGGATGG + Intronic
1141138363 16:81481374-81481396 GAGGACAGGGCCGCTCAGGAAGG + Intronic
1141463892 16:84194619-84194641 GGGGACAAGAGGACTGAGGCTGG + Intronic
1142284391 16:89165789-89165811 GAGGCCTGGGGCACTGAGGGAGG + Intergenic
1142761052 17:2042119-2042141 GAAGACCGGGGCGCTGAGGAAGG + Exonic
1143055322 17:4158044-4158066 GGGGACAGGGGCAGTGAGTACGG - Intronic
1143055331 17:4158080-4158102 GGGGACAGGGGCAGTGAGCACGG - Intronic
1143055340 17:4158115-4158137 GGGGACAGGGGCAGTGAGCACGG - Intronic
1143079361 17:4369910-4369932 GAAGAGAAGGGCTCTGAGGCAGG - Intergenic
1143341727 17:6216303-6216325 AAGGACACGGGAACTGAGGGCGG + Intergenic
1144003053 17:11073393-11073415 GAAAAGGAGGGCACTGAGGAAGG - Intergenic
1144021667 17:11243767-11243789 GAGGCCAAGGCCACAGGGGAAGG - Intronic
1145060098 17:19727859-19727881 GAGGACAAGGGCAGATGGGAAGG - Intergenic
1145940059 17:28738646-28738668 GGGGAGAAGGGCAGTGAGGAAGG - Intronic
1145998472 17:29117756-29117778 GATGAGAAGGGCACTAAGGCAGG - Intronic
1146904276 17:36608208-36608230 AAGGACAAGGGAAGAGAGGACGG - Intronic
1146927341 17:36754178-36754200 CAGCACAAAGGCCCTGAGGAAGG + Intergenic
1147324359 17:39663224-39663246 GAGGACCAGGGCCCTGGGCAGGG + Exonic
1148224863 17:45892292-45892314 GAGGACAAGGGCTCAGATGATGG + Intergenic
1148331199 17:46814933-46814955 GAGGACAAGGGCAGTGAGCTGGG - Intronic
1148439134 17:47702767-47702789 GAGGCCAAAGGCAGTGATGAGGG + Intronic
1150971749 17:70036003-70036025 GCAGACAAGGGAAGTGAGGAAGG - Intergenic
1152019478 17:77772915-77772937 GAGGAAAAGGGAAGTGAGGGGGG - Intergenic
1152585819 17:81189040-81189062 GAGGATGGGGGCACTGGGGAAGG - Intergenic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1155067413 18:22279750-22279772 GCGTACAAGGGCAGGGAGGAGGG + Intergenic
1155362318 18:25015795-25015817 CAGGACAAGCCCACTGAGGCTGG - Intergenic
1156540279 18:37903036-37903058 GTGGAGAAGGGCAGTGATGATGG + Intergenic
1157197004 18:45627610-45627632 GTGGGAAGGGGCACTGAGGAAGG + Intronic
1157422596 18:47559177-47559199 GAGGAGCTGGACACTGAGGAGGG - Intergenic
1159140480 18:64388578-64388600 GAGGTCAAAGGCATTAAGGAAGG - Intergenic
1159790608 18:72775205-72775227 GAGCATAAGGGCACTGAAAAGGG - Intronic
1160479764 18:79227784-79227806 GAGCCCACGTGCACTGAGGAAGG - Intronic
1161260900 19:3337221-3337243 AAGGCCAAGGGCACTGAGTCAGG + Intergenic
1161312095 19:3600419-3600441 GAGGACGAGGCCGCAGAGGAAGG + Exonic
1161455134 19:4366161-4366183 CAGGCCAGGGGCACTGGGGAGGG + Intronic
1161971990 19:7587305-7587327 AAGGACAAAGGCCCTGGGGAAGG - Intergenic
1162904709 19:13816875-13816897 GGGAATAAGGGCAATGAGGAGGG + Intronic
1162971508 19:14183704-14183726 GAGGACAGGGAGACTGAGGTGGG + Intronic
1163423366 19:17227236-17227258 CAGGAGAGGGGCACTGAGGCTGG + Intronic
1163572280 19:18089692-18089714 GAGTCCAGGGGCACTGAGGAGGG + Intronic
1163636106 19:18437837-18437859 GTGGACCAGGGGGCTGAGGAAGG - Intronic
1163739796 19:19004392-19004414 GAGGACGAGGACGATGAGGATGG - Exonic
1163751608 19:19081568-19081590 GAGGAGAATGCCACTGAGGGTGG + Intronic
1164564596 19:29316834-29316856 CAGCACAAGGGCCCTGGGGATGG - Intergenic
1166072232 19:40394255-40394277 GAGGAAGAGGGCAGTGGGGAAGG - Exonic
1166280657 19:41790661-41790683 GAGGAAACTGGCACTGAGAAAGG - Intergenic
1166545401 19:43631763-43631785 GAGGACAAGAGCAGTGGGGATGG + Intronic
1166731631 19:45062245-45062267 GGGGACAGGGGTGCTGAGGAGGG + Intronic
1166884986 19:45954643-45954665 GAGGACCAAGGAACTGGGGAGGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167211913 19:48138966-48138988 GAGGACAGAGGGACTGAGAAAGG - Intronic
1167262118 19:48464676-48464698 GAGGACGATGAGACTGAGGAAGG + Exonic
1168309802 19:55454745-55454767 GAGGGTCAGGGCACAGAGGAGGG - Intronic
925212335 2:2060685-2060707 GAAGAGAAGGGCAGAGAGGAGGG - Intronic
926010053 2:9400311-9400333 GAGGAGAAGGGAGCAGAGGAAGG - Intronic
926076830 2:9949703-9949725 TTGGACCAGGGCACAGAGGAGGG + Intergenic
926088993 2:10037935-10037957 GAGGACATGGGCACTTGGCAGGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927706452 2:25299320-25299342 GAGAACCAGGGCCCTGGGGAAGG - Intronic
927711177 2:25327331-25327353 GAGCTCAAGGGCCATGAGGATGG - Intronic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927899554 2:26809426-26809448 GAGGGCAGAGGCACTGAGCAAGG + Intergenic
928135092 2:28682158-28682180 GAGGCCAAGGGGACAGAAGATGG + Intergenic
928199761 2:29240086-29240108 GAGGAAAAGGGCAGGGAGGAGGG + Intronic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
929537662 2:42793402-42793424 GAGGGCTAGGACACTGAGGCCGG - Intergenic
931758159 2:65392821-65392843 GAAGACAAGGGCTTGGAGGAGGG - Intronic
932401895 2:71486461-71486483 GAGGACAGTGGCGGTGAGGATGG - Intronic
932560852 2:72867487-72867509 GAAGACAAAGGCACTTGGGAAGG + Intergenic
933154006 2:78951029-78951051 GGGGACAAGAGCACAGAGCAGGG + Intergenic
933732683 2:85469636-85469658 GAGGAAGAGGTGACTGAGGAGGG + Intergenic
934035763 2:88087471-88087493 GAGTACAAAGGCCCTGAAGAAGG - Intronic
936702746 2:115033492-115033514 GAGGACCTTGGCACAGAGGAAGG - Intronic
937111692 2:119371549-119371571 GAGTACATGGGGCCTGAGGATGG - Intronic
937238371 2:120444110-120444132 CAGGACAGGGGCACTGGGGTGGG + Intergenic
938146285 2:128837041-128837063 GAGGAGAGGGGCACTGAAGCTGG - Intergenic
938382403 2:130843968-130843990 GAGGACAGGGACACAGAGGTGGG - Intronic
938390240 2:130899273-130899295 GAAGGCACGGGCACTGAGGTGGG - Intronic
939189273 2:138897281-138897303 GAGGACAATGACAATGAAGACGG + Intergenic
940118802 2:150239928-150239950 GAGGGCAAGGGCACTGTAAATGG - Intergenic
941710316 2:168705009-168705031 GAGGAAAATGACTCTGAGGAAGG - Intronic
941933444 2:170965011-170965033 GACTACAAGGCCACTGAGGTGGG - Intronic
942470542 2:176255220-176255242 GAGGAGGAGGGCTCTGTGGAGGG - Intergenic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
942996261 2:182264013-182264035 GAGCCCAAGGAGACTGAGGATGG + Intronic
943237349 2:185338959-185338981 AAGGAAAAAGGCACTGAAGATGG - Intergenic
944171077 2:196778939-196778961 GCAAACAAGAGCACTGAGGAGGG + Exonic
944665641 2:201956718-201956740 GTGGAGAAGGGCACAGAAGAGGG - Intergenic
944976789 2:205062545-205062567 GAGTGGAAGTGCACTGAGGATGG + Intronic
946989170 2:225308633-225308655 AAGGACAAGGGAGCTGAGGCAGG + Intergenic
947713047 2:232326650-232326672 AAGGTCAAGGGCACTGAGGAGGG - Intronic
947732730 2:232440106-232440128 AAGGTCAAGGGCACTGAGGAGGG - Intergenic
947938724 2:234029469-234029491 GAGGTCAATGGCACTCAGGAGGG - Intergenic
948594371 2:239069996-239070018 GAGGACCAGGACAGAGAGGACGG - Intronic
948603548 2:239120821-239120843 GAGGACAAGGCAGCTGAGGGTGG + Intronic
948768164 2:240233839-240233861 GAGGAAAGAGGCACTGTGGATGG - Intergenic
948815855 2:240510097-240510119 GAAGACAAGGGCAAGGAGGCAGG - Intronic
1169092615 20:2870910-2870932 GAAGAGAAGAGAACTGAGGAAGG - Intronic
1171976135 20:31595946-31595968 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1172356952 20:34286975-34286997 GAGGACTGGGGCACTGAGGCTGG - Intronic
1172433973 20:34915180-34915202 GATGAAAAGGGTAGTGAGGAGGG - Intronic
1172579306 20:36034237-36034259 GAGGATGAGGGTACTGAGAAGGG + Intergenic
1172987018 20:38999831-38999853 CAAGACAAGGGCAGTGAGGATGG - Intronic
1173046264 20:39515755-39515777 GAGGACCAGATCACTAAGGAAGG + Intergenic
1174410092 20:50329725-50329747 AAGTACAAGGGCCCTGAGGCAGG - Intergenic
1175239174 20:57533994-57534016 GAGGAGAAGGGCACCGTGGAAGG - Intergenic
1175418338 20:58816176-58816198 GAGGCCAGGGGCGCTGGGGAAGG - Intergenic
1175429115 20:58890280-58890302 GACGACGAGGGCGCCGAGGAGGG + Intronic
1175609538 20:60339335-60339357 GAGGACAAGGGTCCTGAGGTTGG + Intergenic
1175799110 20:61790962-61790984 GAGGGTGAGAGCACTGAGGATGG - Intronic
1176094538 20:63333876-63333898 AAGGACCAGGGCAGTGGGGACGG + Intronic
1176367879 21:6044691-6044713 GAGACCAAGGGCCCTGTGGACGG + Intergenic
1178899485 21:36587840-36587862 GAAGACAAGAGCCCTGAGGGAGG + Intergenic
1179582399 21:42352015-42352037 GAGGACAGGGGCCTAGAGGATGG - Intergenic
1179612169 21:42559468-42559490 GAGGGCAAGTGCACTGGGGAGGG - Intronic
1180676069 22:17587324-17587346 TAGGACAAGTGCACGGGGGAGGG + Intronic
1181082970 22:20426201-20426223 GTGGTCAAGGGCACAGGGGACGG + Exonic
1181270696 22:21657111-21657133 GAGGAACAGGACACTGAGGAGGG + Intronic
1181430897 22:22881126-22881148 GGGGACACGGACACTGAGGGTGG - Intronic
1181966105 22:26657684-26657706 GGGGACAAGGACACTTGGGAAGG - Intergenic
1182331379 22:29553641-29553663 GGGGACAAGGGCAGTGGGGCTGG - Intronic
1182417258 22:30229357-30229379 GAGGAAAGGGGCAGGGAGGAAGG - Intergenic
1182687510 22:32132536-32132558 GAGGACAAGGGTCCTCAGGCTGG - Intergenic
1182870226 22:33639919-33639941 GAGGGCAAAGGGACTGATGAGGG + Intronic
1183118778 22:35713470-35713492 GGGGAGAAGAGCACTGAGGCTGG - Intergenic
1183252880 22:36742851-36742873 CTGGGCAAGGGCCCTGAGGAGGG + Intergenic
1183492349 22:38123318-38123340 GGGGACAAGGGCTATGAGGGTGG - Intronic
1183506907 22:38214378-38214400 GAGGTCCAGGGGACTGGGGACGG - Intronic
1183586637 22:38756442-38756464 GAGGACAACGGCACTGGTGCCGG - Intronic
1183659178 22:39208317-39208339 GGGGACAAGGGCTCTGATGAGGG + Intergenic
1183759477 22:39802926-39802948 GAGGACAAAGGCACTGGCAATGG - Intronic
1184332063 22:43833524-43833546 GAGGAGGAGGGGTCTGAGGAGGG - Intronic
1184499340 22:44862366-44862388 GGGCACAAGGGCACTCAGGGAGG - Exonic
1184572106 22:45331897-45331919 GAGGGCAAGAGAGCTGAGGAGGG - Intronic
1185279517 22:49964112-49964134 GAAGAGAGGGGCTCTGAGGAAGG + Intergenic
1185373922 22:50473560-50473582 GAGTAAGAGGGCACTGAGGAGGG + Intronic
949489373 3:4573670-4573692 GAGGACAAAGGCCCTGAGGCAGG - Intronic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950426604 3:12927854-12927876 GAGGACAAAGGTGCTGAGGTGGG + Intronic
950443304 3:13022324-13022346 CAGGACCAGGGCACAGAGGCTGG - Intronic
950704064 3:14769296-14769318 GAGGGAAAAGGCACTCAGGAGGG + Intronic
950836861 3:15928615-15928637 CAGGAGAATGGCACAGAGGAGGG + Intergenic
952277794 3:31894300-31894322 GAGGACAAGGGGAGGCAGGAAGG + Intronic
952890031 3:38033720-38033742 GAGGACAAGGCCAATGTGGCTGG + Intergenic
953136640 3:40187714-40187736 GAGGACAAGGTCCCTGAGGCAGG - Intronic
953172414 3:40519335-40519357 TAGGACAGGGGGACTGAGGCAGG - Intergenic
953435316 3:42873046-42873068 GGAGACATGGGCACTGAGGAGGG + Exonic
953872015 3:46635008-46635030 GAGGGCAAGGGCAGTGGGGTTGG - Intergenic
953891231 3:46753128-46753150 GGCCACTAGGGCACTGAGGAAGG + Intronic
953899172 3:46829637-46829659 GGCCACTAGGGCACTGAGGAAGG + Intronic
954225194 3:49176697-49176719 GAGCACTAGGGCAGTAAGGAAGG + Intergenic
954377433 3:50202519-50202541 GAGGGGAAGGGCACTGTGGATGG - Intergenic
954706177 3:52481781-52481803 GGGCACAAGGGGAGTGAGGAGGG - Intronic
954882283 3:53844387-53844409 GAGACCAAGGGCACTGAGGCTGG - Intronic
955111938 3:55958615-55958637 GAGGCCAGGGGTGCTGAGGATGG - Intronic
955753229 3:62203512-62203534 GACGGCGAGGGCACCGAGGAAGG + Exonic
955877346 3:63506130-63506152 GAGGAAAAGGGAAGAGAGGAAGG - Intronic
955979734 3:64512735-64512757 GAGGACAATGGCTTTGAGAATGG + Intergenic
956011172 3:64833222-64833244 GAGGAATAGGCCACTGAGAATGG + Intergenic
956125360 3:66005851-66005873 GAGGGAAAGGGCACTTAGGAAGG + Intronic
956791418 3:72683099-72683121 CAGGACAAGGGCCCTGGGGTGGG - Intergenic
956982510 3:74654908-74654930 GAGCAGCAGGGCACTGAAGAAGG + Intergenic
958662386 3:97087670-97087692 GAAGACAATCTCACTGAGGAAGG - Intronic
960699589 3:120427210-120427232 AAGTAAAAGGTCACTGAGGATGG - Intronic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
961509887 3:127394256-127394278 GAAGAGCAGAGCACTGAGGATGG + Intergenic
962396020 3:135015897-135015919 CAGGACAAAGGCCCTGAGGTGGG + Intronic
962665452 3:137649632-137649654 GAGAACTAGGGGACAGAGGAGGG - Intergenic
962867287 3:139458258-139458280 GAGGGCAAGTGCGCTAAGGAGGG - Intronic
963280090 3:143375915-143375937 CAAGACAAGGGCCCTGAGGCAGG - Intronic
963298853 3:143577239-143577261 GAGGATGAGGGGACTCAGGAGGG - Intronic
966002125 3:174962610-174962632 GAGAAGAAGGGTACCGAGGACGG + Intronic
966833679 3:184032690-184032712 CAAAACAATGGCACTGAGGATGG + Intronic
966837535 3:184060318-184060340 GAGGACAATGACAGTAAGGATGG - Exonic
968483123 4:845631-845653 GAGCTCCAGGGCTCTGAGGAAGG - Intergenic
968891718 4:3372948-3372970 GAGGCCATGGTCGCTGAGGAAGG + Intronic
969306867 4:6330865-6330887 GAGGACACGGGGGCTGGGGAGGG - Intronic
969368640 4:6716342-6716364 GAGGACGAGGGCGCGGAGGACGG + Exonic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970031730 4:11684000-11684022 GAGGAGAAAGCCACTGAGCAGGG - Intergenic
970892707 4:21066449-21066471 GAGGAAAGAGGCACTGAAGAGGG + Intronic
972230910 4:37071931-37071953 GATGACAAGGGGGCAGAGGAAGG - Intergenic
972741061 4:41886539-41886561 GGGGACAAGGTGCCTGAGGAGGG - Intergenic
973895049 4:55403873-55403895 GAGAATAAAGGCACTGAGGGAGG - Intronic
974958547 4:68672898-68672920 GAGGATAAAGGCAATGAGGGCGG - Intergenic
975480244 4:74870656-74870678 GATGCTAAGGGCACTGAGGAAGG - Intergenic
976088539 4:81430594-81430616 GAGCAGCAGGGCACTGAAGAAGG + Intronic
976244070 4:82990050-82990072 GTGGGCAAGGGCAGTGGGGATGG - Intronic
977074348 4:92433642-92433664 GAGGACAGAGGCACTGAAGGGGG - Intronic
977167021 4:93711812-93711834 GAGGAAAGAGGCACTGAGGAGGG - Intronic
978321384 4:107499760-107499782 GAGGGCAAGGGCACAGGGAAAGG - Intergenic
980073433 4:128267163-128267185 GAAGACATGGGTAGTGAGGATGG + Intergenic
981155903 4:141434668-141434690 GAAGACAATGGCAGTGAGAATGG - Intergenic
981836709 4:149063833-149063855 AAGGAAAGGGGCACTGAAGAAGG + Intergenic
982158985 4:152548469-152548491 GAGGACAGCGACACTGGGGAGGG - Intergenic
982190545 4:152850468-152850490 GGGGACGAGGGCAGTGAGGAAGG + Intronic
982746589 4:159109854-159109876 GGGAACCAGGGGACTGAGGAGGG + Intronic
983942285 4:173547628-173547650 GAGGACAAGGGCTGTGAGACAGG + Intergenic
984783973 4:183551761-183551783 GAGGCCAAGAGACCTGAGGAGGG + Intergenic
984833498 4:183998350-183998372 TAGGACAGGGGCACTGAGGCCGG - Intronic
986313743 5:6572648-6572670 GAGGTCAGGGGCAGTGAGGACGG + Intergenic
987017382 5:13834716-13834738 GAGGGCAAGGGCCCTGTGGCAGG + Intronic
987287683 5:16474880-16474902 GAGGACACAGACACTGAAGAAGG - Exonic
989110385 5:37901764-37901786 GAGGGCAAGGGAAGGGAGGAAGG + Intergenic
990879223 5:60520916-60520938 TAGGACAGGGGCAGTGAGGGAGG - Intronic
992004067 5:72460916-72460938 GAGGACGAGGGCACGAAGAAGGG + Exonic
993273000 5:85819006-85819028 GGTAAGAAGGGCACTGAGGATGG - Intergenic
995230941 5:109762590-109762612 GAGGACAATGGCAATGTGGCAGG + Intronic
997289637 5:132719146-132719168 GAAGAAATGGGCACTGAGGATGG - Intronic
997472224 5:134123455-134123477 TGGGAAAAGGGCACAGAGGAGGG + Intronic
997518925 5:134509705-134509727 GAGTACAAAGGCCCTGAGGCAGG + Intergenic
997862304 5:137428926-137428948 AAGAACAAGGGCACTCAGGTTGG - Intronic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
999988948 5:157031963-157031985 GAGTGCAAAGGCACTGAGGTAGG - Intronic
1000286784 5:159833709-159833731 AAGAGCAAAGGCACTGAGGAAGG + Intergenic
1000659172 5:163917435-163917457 CGGGACAATGGCACAGAGGAGGG - Intergenic
1001086177 5:168701546-168701568 GAGGGCAGCGGCCCTGAGGAAGG + Intronic
1001175087 5:169460969-169460991 GAGGAAATGGGCATTGAAGATGG - Intergenic
1001268291 5:170291156-170291178 GAGGACAAGGGAAGGGAGGAAGG + Intronic
1001406216 5:171479558-171479580 GAGGACAGGAGCCCAGAGGAAGG + Intergenic
1001557255 5:172645232-172645254 GAGGTCAAGGACACAGAGTAAGG + Intronic
1001630247 5:173169583-173169605 GAGGACGAGGTCCCTCAGGATGG - Intergenic
1001752973 5:174145583-174145605 GTGGACTAGGGAACTGAGCAAGG + Intronic
1001963412 5:175894206-175894228 GAGGTCTAGGGCTGTGAGGAAGG + Intergenic
1002055803 5:176597385-176597407 GAGGACGCGGGCACTCAGGCGGG - Exonic
1002441799 5:179268162-179268184 GAGGTCAAGGGAGTTGAGGAGGG + Intronic
1002492199 5:179586511-179586533 AAGGACAAGGGCTCTGAGAGGGG + Intronic
1002684346 5:180996274-180996296 GAGGAGGAGGGCTCTGAGAAGGG - Intronic
1002711700 5:181198809-181198831 CAGGACAAGGGCTCTGAGAAGGG + Intronic
1002763375 6:218673-218695 GAGGACAGGGGCCCTGAGGGGGG - Intergenic
1003030770 6:2598780-2598802 GAGCGCATGGGCACTGAGGAAGG - Intergenic
1003190914 6:3873740-3873762 GAGGAAAAGGACAGAGAGGAAGG + Intergenic
1003456829 6:6291242-6291264 GAGGACAGGGGCACGGGTGAGGG - Intronic
1003523166 6:6875927-6875949 GAGGTCAAGGGCGCTGGTGATGG + Intergenic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004303321 6:14477885-14477907 CAGGACAAGGGCAGTCAGAAGGG - Intergenic
1004347224 6:14859670-14859692 GATGAAGAGTGCACTGAGGAGGG + Intergenic
1004348795 6:14872704-14872726 GGGGAGAAGGGCAGTGGGGAAGG + Intergenic
1004610135 6:17232149-17232171 AAGGACAAGGGCCCTGAAGCTGG + Intergenic
1005279872 6:24262065-24262087 AAGGAGAAAGGCACTGAAGATGG + Intronic
1005799399 6:29405161-29405183 GAGGAACAGGACACTGAGGGTGG + Intronic
1006336352 6:33422830-33422852 GGGGAGGAGGGCACAGAGGAGGG + Intronic
1006385532 6:33728753-33728775 GAGGCAGAGGGCACGGAGGAGGG - Intronic
1006501465 6:34461829-34461851 GAGAAAAAGTGCACTGAGGCCGG + Intergenic
1006510127 6:34516967-34516989 GGGGTCAAGGGCAGTGAGGAGGG - Intronic
1006583311 6:35088978-35089000 GAGGACAGGGGAGCTGAGGTTGG + Exonic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007218749 6:40261999-40262021 GAGGCCAAGGCCACAGAGGCTGG - Intergenic
1007645569 6:43377961-43377983 GAGGACAAGGACAGTGAAAAGGG - Intergenic
1010097815 6:72067364-72067386 AAGTACAAAGGCACTGAGGGAGG - Intronic
1010560359 6:77341356-77341378 TAGGATAAGGGCACTGGGCAGGG - Intergenic
1011662772 6:89608606-89608628 GAGGGCAAAGCCACTGAGGTGGG - Intronic
1012398733 6:98827697-98827719 GAGGACCTGGGCACTGAGCAAGG - Intergenic
1014349482 6:120322230-120322252 GAAATAAAGGGCACTGAGGAAGG + Intergenic
1016305704 6:142681443-142681465 GAGTACAAATGCACTGAGGCAGG + Intergenic
1017978078 6:159375392-159375414 TAGGACTGGGGGACTGAGGACGG - Intergenic
1018152816 6:160956164-160956186 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1018178548 6:161200048-161200070 GAAAGGAAGGGCACTGAGGAGGG + Intronic
1018469668 6:164084235-164084257 GAGGACATGGACTCTGAGGCGGG - Intergenic
1018651053 6:165991478-165991500 CACGACAAGGGCACTGGTGAAGG + Intergenic
1018670582 6:166173505-166173527 AAGAACAAGGGTACTCAGGAAGG + Intergenic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019274247 7:167474-167496 GAAGAAAAGGGCTCTGAGGCTGG - Intergenic
1019855187 7:3598604-3598626 GGGGACAAGGGAAATGAGGAAGG - Intronic
1020014910 7:4825202-4825224 GAGGGGAAGGGCACTCAGCAGGG + Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1021592029 7:22273979-22274001 GATGACAAGGTAAATGAGGATGG - Intronic
1021883571 7:25116468-25116490 GAGGACAAGGGGGTTGAGAATGG + Intergenic
1022011375 7:26310645-26310667 CAGCACGAGGGGACTGAGGAAGG + Intronic
1022029467 7:26479160-26479182 AAGTGCAAGGGCACTGAGCAGGG - Intergenic
1022857872 7:34333617-34333639 GAGGACAAGGGATTTTAGGATGG - Intergenic
1025850470 7:65239675-65239697 GAGGCCGCGGGCACCGAGGAGGG - Intergenic
1025932537 7:66007826-66007848 GAGGACAAGGGGGGTGAGGCAGG + Intergenic
1026061803 7:67033223-67033245 GAGGGACAGGGCACAGAGGAGGG - Intronic
1026419639 7:70220728-70220750 GAGGAAGGGGGAACTGAGGATGG + Intronic
1027141673 7:75662009-75662031 GTGGACAGGGTCTCTGAGGAGGG + Intronic
1027672350 7:81117703-81117725 GAAGACAAGGGGACTCTGGATGG - Intergenic
1028303950 7:89238178-89238200 GAGAACAAGGGCATTAATGAGGG + Intronic
1029537149 7:101163531-101163553 GAGGCCGAGGGGACAGAGGAGGG - Exonic
1029794057 7:102875380-102875402 GAGGACAGGGGAAAAGAGGAGGG + Intronic
1031122614 7:117738767-117738789 GAGGGTGAGGGCATTGAGGAAGG + Intronic
1032193814 7:129778925-129778947 GGGGGCAGGGGCACTGAGGCCGG - Intergenic
1032478053 7:132225757-132225779 GCAGAGAAGGGAACTGAGGAGGG - Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033534440 7:142298947-142298969 GACGACAAGGACACAGAGCAGGG + Intergenic
1034277613 7:149830556-149830578 GAGGAGGAGGGGACTGTGGAGGG - Intergenic
1034312410 7:150100321-150100343 GAGGCCAGCTGCACTGAGGATGG - Intergenic
1034677977 7:152905424-152905446 GAGGACAAGCTCCCTGAGGATGG + Intergenic
1035013349 7:155740668-155740690 GAGGACAAGGGCAATGACTGTGG - Intronic
1035593934 8:839701-839723 CAGGACAGGGGCACTTAGGGTGG - Intergenic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1036226233 8:6960126-6960148 CAGGAGAATGGCAGTGAGGAGGG + Intergenic
1037948095 8:23001821-23001843 AAGGACAAGGGGACTGCTGAAGG + Intronic
1038168399 8:25106635-25106657 CACGAGAATGGCACTGAGGATGG - Intergenic
1038242374 8:25821800-25821822 GAGGAGGAGGCCACTGAGGGAGG + Intergenic
1038319377 8:26513745-26513767 GAGGAGAGGGGCACTGGGGCTGG + Intronic
1039230920 8:35447017-35447039 GAGGATAATGGCAATGATGATGG - Intronic
1039359917 8:36864920-36864942 AAGGAAAAGGGCAGGGAGGAGGG - Intronic
1039400176 8:37262548-37262570 GAAGACAAAGACACTGAGGCTGG - Intergenic
1039827758 8:41189403-41189425 AAGCCAAAGGGCACTGAGGATGG - Intergenic
1039835569 8:41253741-41253763 GAGGGCAATGGCAGTGGGGAGGG + Intergenic
1039902359 8:41762142-41762164 GAGGACAAGGGAGGTGAGAAGGG - Intronic
1040481779 8:47833399-47833421 GGGAACAAGGGCCCAGAGGAAGG - Intronic
1040535129 8:48302519-48302541 GAGGACAAGGCCATGGATGAGGG + Intergenic
1040549548 8:48427815-48427837 GAGGACATGGGCAGTGTGGGAGG - Intergenic
1041654883 8:60338997-60339019 TAGGACAAGGGCAATGGGAATGG - Intergenic
1042220293 8:66466824-66466846 GAGGGGAAGGGCCCTGAGGCAGG + Intronic
1044001189 8:86883481-86883503 GAAGACAAGGGTAATGAGAATGG + Intronic
1044749095 8:95399368-95399390 GAGGACAAGTGACTTGAGGAAGG + Intergenic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1045414730 8:101954381-101954403 GAGGTCAGGGGAAATGAGGAGGG - Intronic
1045476428 8:102556681-102556703 GAGGACAATGTCACTCAGCAGGG - Intronic
1047170430 8:122487296-122487318 GAGGAGTAGGGCACTGGGGGCGG - Intergenic
1047209376 8:122828650-122828672 GTGGCCATGGGCACTGAGAAGGG + Intronic
1047347264 8:124040292-124040314 GAGGCCAAGTGCAGTGGGGAAGG + Intronic
1048030034 8:130622206-130622228 AAGGAAAGAGGCACTGAGGAGGG - Intergenic
1048265269 8:132980070-132980092 TAGGACAAGGGGGCTGGGGAAGG + Intronic
1048284382 8:133130482-133130504 AAGGACTTGGCCACTGAGGATGG + Intronic
1048669100 8:136696173-136696195 GAGAACTAGGGCAGTGAGAAAGG + Intergenic
1048871705 8:138804373-138804395 GAGGAGAAGAGCACTGAAAAGGG - Intronic
1048886921 8:138916206-138916228 GAGGAGCAGGGCACAGATGAGGG + Intergenic
1049683929 8:143931735-143931757 CAAGACGGGGGCACTGAGGAAGG + Intronic
1050248039 9:3712889-3712911 GTGGAAAGGGGCACTGAGGAGGG + Intergenic
1050589740 9:7149117-7149139 GAGGCCAAGGGGCCTGAGGGCGG - Intergenic
1051464764 9:17365249-17365271 GAGGAAAAGAGCACAGAGGGAGG - Intronic
1053054641 9:34987427-34987449 CAGGACAATGGGACTGAGGGCGG + Intergenic
1053057119 9:34999887-34999909 GGGGACACTGGCACTCAGGAGGG - Intergenic
1053141339 9:35684701-35684723 GAGCAGAGGGGCAGTGAGGATGG - Intronic
1055945327 9:81687971-81687993 GCGGACAGGGGCGCTGGGGAAGG - Intronic
1056404280 9:86259234-86259256 GAGGATGAAGGCACTGAGGTTGG + Intronic
1056794001 9:89644413-89644435 GGTGACAGGGCCACTGAGGAGGG + Intergenic
1056989328 9:91395540-91395562 GGGAACAAGGACGCTGAGGATGG + Intergenic
1057725867 9:97567764-97567786 GAAGTGAAGGGCACTGAGGAGGG + Intronic
1057860316 9:98635728-98635750 GAGGACAAGTTCACTGTGGCTGG + Intronic
1057905950 9:98983593-98983615 GAGCTCAAGGGCACAGAGGCAGG + Intronic
1057921821 9:99104528-99104550 CATGTGAAGGGCACTGAGGAGGG + Intronic
1058908970 9:109503788-109503810 GAGTACAAGAGCAGTGATGAAGG + Intergenic
1059730886 9:117055754-117055776 GAGGGCAAGGGGACTGAGGGAGG + Intronic
1060069929 9:120537363-120537385 GAGGGCAAGGGCAGGGAGGAGGG - Intronic
1060726399 9:126008745-126008767 GAGGACAATTGCCCAGAGGAAGG + Intergenic
1060924963 9:127449925-127449947 AAGCACATGGGCACTTAGGAGGG - Intronic
1060965989 9:127712619-127712641 GTGGAAATGGGCACTGAGGTTGG + Intronic
1060979833 9:127785719-127785741 GAGGAGCAGGGCACTGCGGCTGG + Intronic
1061912309 9:133731656-133731678 AAGGAGCAGGGCACTGAGGCAGG + Intronic
1062513981 9:136922886-136922908 GAGGACTAGGACAGGGAGGATGG + Intronic
1062716463 9:138012853-138012875 AAGCAAGAGGGCACTGAGGAAGG + Intronic
1203761551 EBV:14966-14988 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203762480 EBV:18038-18060 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203763409 EBV:21110-21132 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203764338 EBV:24182-24204 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203765267 EBV:27254-27276 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203766196 EBV:30326-30348 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203767125 EBV:33398-33420 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1187019323 X:15363762-15363784 GAAGACAGGGACACAGAGGAAGG + Intronic
1188071939 X:25727800-25727822 AAGGAAAAAGGCACTGAAGAGGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188547295 X:31322230-31322252 GAGGACAAAGACACTGATGTAGG + Intronic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1189351620 X:40279874-40279896 GAGGCAAAGGGAGCTGAGGAAGG - Intergenic
1189425361 X:40895614-40895636 AAGGGCAAGGCCACTGAAGATGG - Intergenic
1190063080 X:47223261-47223283 GAGGGCAAGGGCCCTAACGATGG - Exonic
1190341890 X:49303618-49303640 GTGGACATGCGCACTGAGGCGGG - Intergenic
1190713554 X:53086289-53086311 GAAGAAGAGGGCATTGAGGAAGG + Exonic
1190915115 X:54805833-54805855 GAAGAGAAGGGCAAGGAGGAGGG - Intergenic
1191899616 X:66027300-66027322 ATGGTCAAGGGCACTGAGGATGG - Intronic
1192182623 X:68925848-68925870 GAGGACTAGGCCAGAGAGGAAGG + Intergenic
1193234123 X:79085582-79085604 GAGGAAAAAGGCTTTGAGGATGG + Intergenic
1194806306 X:98332455-98332477 GAGGAGGAGGGTACAGAGGAAGG + Intergenic
1195366957 X:104135563-104135585 GAGGGCAATGGCAGTGAGTATGG - Intronic
1195382466 X:104283943-104283965 GGGGAAGGGGGCACTGAGGAGGG - Intergenic
1196189304 X:112778462-112778484 GAGGACAAGGGTTGTGGGGAGGG - Exonic
1197887576 X:131234616-131234638 GAGGAGAAGGTGTCTGAGGAGGG - Intergenic
1197944902 X:131828120-131828142 GAGGAGAAGGGCTCTGGGGGTGG - Intergenic
1200059172 X:153476660-153476682 GAAGACTGGGGCACTGAGGAGGG + Intronic
1200073488 X:153540198-153540220 GCAGACAAGGCCACTGAGGCCGG - Intronic
1200118258 X:153778677-153778699 GAGGCCCAGGGCACTCCGGAGGG + Intronic
1202090038 Y:21179569-21179591 GACCACAAGAGGACTGAGGAAGG + Intergenic