ID: 1078067394

View in Genome Browser
Species Human (GRCh38)
Location 11:8087369-8087391
Sequence CAAGCCACTCACACTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078067394_1078067400 25 Left 1078067394 11:8087369-8087391 CCTCTGAAAGTGTGAGTGGCTTG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1078067400 11:8087417-8087439 GCCCCTCCTGCTGGCACAAAGGG 0: 1
1: 0
2: 3
3: 19
4: 216
1078067394_1078067398 16 Left 1078067394 11:8087369-8087391 CCTCTGAAAGTGTGAGTGGCTTG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1078067398 11:8087408-8087430 TGTGGAATGGCCCCTCCTGCTGG 0: 1
1: 0
2: 1
3: 20
4: 179
1078067394_1078067396 3 Left 1078067394 11:8087369-8087391 CCTCTGAAAGTGTGAGTGGCTTG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1078067396 11:8087395-8087417 CAACCTAGAAAACTGTGGAATGG 0: 1
1: 0
2: 0
3: 22
4: 208
1078067394_1078067399 24 Left 1078067394 11:8087369-8087391 CCTCTGAAAGTGTGAGTGGCTTG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1078067399 11:8087416-8087438 GGCCCCTCCTGCTGGCACAAAGG 0: 1
1: 0
2: 0
3: 19
4: 238
1078067394_1078067395 -2 Left 1078067394 11:8087369-8087391 CCTCTGAAAGTGTGAGTGGCTTG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1078067395 11:8087390-8087412 TGCGACAACCTAGAAAACTGTGG 0: 1
1: 0
2: 0
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078067394 Original CRISPR CAAGCCACTCACACTTTCAG AGG (reversed) Intronic
900567782 1:3342355-3342377 CAAGCCACCCACTACTTCAGTGG + Intronic
901739835 1:11334830-11334852 CCAGTCACTCTCATTTTCAGGGG + Intergenic
906591485 1:47028968-47028990 CAAGACTCTCAACCTTTCAGTGG + Intronic
906931696 1:50176437-50176459 CCAGCCACACCCACATTCAGAGG - Intronic
908174132 1:61537734-61537756 CAGGCCACACACACATTCATTGG - Intergenic
908232275 1:62117606-62117628 CTAGCCACTCACACATGCCGAGG + Intronic
909170631 1:72289130-72289152 AAAGCCAGTCATTCTTTCAGAGG - Intergenic
910425517 1:87116715-87116737 GAAGCCACTGAGACTTTCTGAGG - Intronic
911063038 1:93764228-93764250 CAATCCTCCCACACTTCCAGGGG + Intronic
911415773 1:97571391-97571413 CAAGTCACTTAAACTTTCTGAGG - Intronic
911583871 1:99667833-99667855 CATGCCATTCTCACTTTCAGGGG + Intronic
920139417 1:203796847-203796869 CCAGCCACTCACATTTTAAAAGG + Exonic
920357093 1:205381913-205381935 CAAGACCCACACACTTTAAGGGG - Intronic
921944006 1:220874029-220874051 CAAGCCACTTAACCTTTCTGAGG + Intergenic
1068311399 10:55281177-55281199 GAAGCCACTCAGAAATTCAGAGG + Intronic
1068492139 10:57737651-57737673 CCAGCCCCTCACACCTTCACAGG + Intergenic
1070563448 10:77585174-77585196 CAGGCCACTCAGACTATCGGGGG + Intronic
1073456489 10:103639924-103639946 CAAGACACTTACATTCTCAGAGG + Intronic
1074890112 10:117728841-117728863 CAACCCACTCACACATACACAGG - Intergenic
1074990664 10:118703677-118703699 CAAGCTTCTCACACTTTTGGTGG - Intronic
1076307149 10:129473481-129473503 CAAGTCACTCAAACTCTCCGAGG - Intronic
1077390944 11:2300396-2300418 CAAGCCACTTCCTCTTGCAGAGG + Intronic
1078067394 11:8087369-8087391 CAAGCCACTCACACTTTCAGAGG - Intronic
1079693121 11:23444714-23444736 CAAGCCACACACACTTCAGGTGG - Intergenic
1081550733 11:44109543-44109565 CAAGCCTGTCACACTTTTGGGGG - Intronic
1082798508 11:57396075-57396097 CGAGCCATTCACCCTTGCAGTGG - Intronic
1083849294 11:65355650-65355672 CTAGCCACTTCCTCTTTCAGCGG + Intronic
1087005695 11:93468409-93468431 TAAGCCACTCACAAATCCAGGGG + Intergenic
1087403573 11:97699727-97699749 CAAGTCACTCAAACTTTATGTGG + Intergenic
1088062010 11:105665356-105665378 CAAGTAACTTAAACTTTCAGGGG - Intronic
1088511848 11:110583795-110583817 CAAGCAACTCTCACTTTGAATGG + Intronic
1089795171 11:120974440-120974462 GCAGCCACTCTCAGTTTCAGAGG - Intronic
1090280657 11:125453285-125453307 AAAGCCACACACACTGTCAGTGG - Intronic
1090794793 11:130125413-130125435 CAAGACACTCGCAAGTTCAGTGG - Intronic
1095687532 12:45051740-45051762 CAAACAACCCACTCTTTCAGAGG - Intergenic
1095695945 12:45144201-45144223 CAGGGAACTCTCACTTTCAGTGG + Intergenic
1095953907 12:47795894-47795916 CCAGCCACTCACCCTGGCAGGGG + Exonic
1099169074 12:79342020-79342042 CACGCCACCTACACTTTCAGAGG - Intronic
1099428906 12:82557253-82557275 TAAGCCATTCAGAGTTTCAGGGG + Intergenic
1100872337 12:98923156-98923178 CAACCCATTCTCACTTTCAAGGG - Intronic
1102931995 12:116869431-116869453 CAAGCCACTCACATGTAGAGGGG + Intronic
1104437130 12:128765400-128765422 CAGGCCACTCAGACTCCCAGAGG + Intergenic
1104911165 12:132241474-132241496 CACGCCACACACCCTTCCAGGGG + Intronic
1105286961 13:19012323-19012345 CAGGCCCCTCACCCTTGCAGAGG - Intergenic
1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG + Exonic
1106538760 13:30671689-30671711 CAAGCAACTCACTGTTTCCGGGG + Intergenic
1107799311 13:44089305-44089327 CAAGCCACCAACAGTTTCAGTGG - Intergenic
1108596815 13:51956423-51956445 CTAACCACTCCCATTTTCAGAGG - Intronic
1112243951 13:97711190-97711212 CAAGCCACTCAAAATCTCAGTGG - Intergenic
1113073804 13:106448540-106448562 CAAGGCACCCACAAATTCAGGGG - Intergenic
1116279084 14:42878893-42878915 CAAGCCACGCACACATCTAGTGG - Intergenic
1118317477 14:64734060-64734082 CAATCCACACACACATTCAGGGG - Intronic
1119658667 14:76435393-76435415 CAAGACGCTCATACTTTCATAGG - Intronic
1119760926 14:77151386-77151408 CAAGCCCCTCACTCCTTAAGTGG - Intronic
1120275477 14:82367978-82368000 CAAGCCACACACCCATTCAGTGG + Intergenic
1121052269 14:90827244-90827266 CCAGCCACTCTCACTTTGACAGG - Intergenic
1122644058 14:103179867-103179889 CATGCCTGTAACACTTTCAGAGG + Intergenic
1122831270 14:104397570-104397592 CAAGGCCTTCACACTCTCAGGGG - Intergenic
1124845335 15:33284469-33284491 CAAACCACTCCCACACTCAGTGG + Intergenic
1125849780 15:42891813-42891835 CAAGCCACTCAAATTTTCCCTGG - Intronic
1128451934 15:67810891-67810913 CAGGCCTCTCAGACCTTCAGGGG + Intergenic
1128729489 15:70011110-70011132 CAAGCCATCCAAACTCTCAGAGG + Intergenic
1128868202 15:71132008-71132030 TAAGCCATTCACATTTTGAGGGG + Intronic
1129350094 15:74951016-74951038 CAATCCACTCCCACTTACACAGG + Intergenic
1129359002 15:75012795-75012817 CATGGCACTCACACATCCAGAGG - Exonic
1131789240 15:95946447-95946469 CAAGACAGTCTCATTTTCAGAGG - Intergenic
1132223355 15:100121992-100122014 CAAGCCTCTCCCTCATTCAGTGG + Intronic
1132776398 16:1597203-1597225 CAGGCCACTCACGCCTTCTGGGG - Intronic
1137019862 16:35414623-35414645 GAATCCACTCACACTTACAGTGG - Intergenic
1145261645 17:21358063-21358085 CCAGCCACTTACACCTGCAGGGG - Intergenic
1146262122 17:31428648-31428670 CATGCCAGGCACTCTTTCAGGGG - Intronic
1147434690 17:40402560-40402582 CATCCCAGTCACCCTTTCAGTGG - Intronic
1151510763 17:74558228-74558250 CAAGCCAGACATCCTTTCAGGGG - Intergenic
1156577590 18:38336411-38336433 CAAGCCACACACACTATCTCTGG - Intergenic
1157573850 18:48730808-48730830 GAAGCCCCTCACACTGCCAGAGG - Intronic
1164517408 19:28948109-28948131 CAAGCCTCTCACGCTGTCATGGG + Intergenic
1165155962 19:33787999-33788021 AAAGACACACACAATTTCAGCGG + Intergenic
1166452827 19:42916410-42916432 CAAGCCACCCAAAGTTTCCGAGG - Exonic
1168198192 19:54791240-54791262 CAAGCCACACATTCTTTCTGGGG - Intronic
930024393 2:47021426-47021448 CAAGGAGCTCAAACTTTCAGGGG - Intronic
930753402 2:54953449-54953471 CAACACACACACACTTGCAGAGG - Intronic
931108574 2:59084899-59084921 CATGCCACTCACACTTACACAGG + Intergenic
933261428 2:80135754-80135776 CAAGCAACTCATATTTACAGAGG - Intronic
933434531 2:82229935-82229957 CAAGCCACTTACATTTTAATGGG + Intergenic
935442624 2:103119346-103119368 CAAGGCACACACACATTCATAGG - Intergenic
938120829 2:128631985-128632007 CAAACCACTCTCCCTATCAGAGG + Intergenic
938613894 2:132977970-132977992 CAAACCACTCACAGCCTCAGTGG + Intronic
939423421 2:142003430-142003452 AAAGCCAACCACCCTTTCAGTGG + Intronic
942658169 2:178236592-178236614 AAAGCCAATCACACTGTCACTGG - Intronic
943028409 2:182656330-182656352 CAAACCACTCAGATTTTTAGAGG - Intergenic
943152253 2:184129667-184129689 CATACCACTCACACTTTCACTGG - Intergenic
947374797 2:229484659-229484681 GATGCCAGTCACACCTTCAGAGG - Intronic
948408222 2:237739019-237739041 AAAGCCAATCACATTATCAGAGG - Intronic
948459565 2:238122641-238122663 CAAGCCCCTCACTCTGCCAGGGG + Intronic
1168997162 20:2142091-2142113 CCAGCCAGAAACACTTTCAGTGG + Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172206816 20:33168199-33168221 CACGCCACTCACGCGTTTAGAGG - Intronic
1173144732 20:40514802-40514824 GAAGCCACTTCCATTTTCAGTGG + Intergenic
1173347460 20:42214124-42214146 AAAGCCACCCAGGCTTTCAGAGG + Intronic
1173371965 20:42444449-42444471 AAAGCCACTCACATTTTGGGGGG + Intronic
1175121492 20:56719409-56719431 CAAGCCAGTCCAACCTTCAGTGG - Intergenic
1175138382 20:56841909-56841931 CAAGCCAGGCACATTTACAGAGG + Intergenic
1175306291 20:57977853-57977875 CAGGCCACTGACACCCTCAGTGG - Intergenic
1178108467 21:29347668-29347690 CAAGCCAGTCACACCTGCAAAGG - Intronic
1181668243 22:24412939-24412961 CAGGCCTCCCACCCTTTCAGGGG - Intronic
1182081048 22:27528998-27529020 CATGCCACTCACAGCTTCGGAGG + Intergenic
1182623636 22:31630893-31630915 CCAGCCACTCAGACTACCAGGGG + Intronic
949691418 3:6644218-6644240 CAAGACGCTCACACTGACAGAGG + Intergenic
951239927 3:20275577-20275599 CAACCCACTGGCCCTTTCAGTGG + Intergenic
953263801 3:41366270-41366292 CAAGGCACACACATTTGCAGTGG + Intronic
953900525 3:46839029-46839051 CCAGCCACACACACATCCAGTGG + Intergenic
954874053 3:53789580-53789602 CAGGCCACGCCCACTCTCAGGGG - Intronic
959437869 3:106339152-106339174 CACACAACTCACACTTTCATGGG - Intergenic
961569175 3:127785949-127785971 CCAGCCACTCAGACACTCAGGGG - Intronic
961822845 3:129584113-129584135 CAAGCCACTCACGCTGTGTGGGG + Exonic
962055373 3:131865896-131865918 CAAGCCACTGACACTTCTATGGG + Intronic
962356671 3:134699993-134700015 CAAGAGGCTCTCACTTTCAGGGG + Intronic
963272742 3:143301884-143301906 CAAGCCACTCTTAATGTCAGTGG + Intronic
966507364 3:180721551-180721573 CTGGGCACTCACACTTTCACAGG - Intronic
967200712 3:187070310-187070332 CCACACACTCACACATTCAGGGG + Intronic
967381768 3:188866898-188866920 CAAGCCTCTCACATATTCAAAGG + Intronic
969501755 4:7557738-7557760 CAAACCACTGCCCCTTTCAGAGG - Intronic
970124798 4:12797336-12797358 CCAGTCACACACACTTTCAGTGG - Intergenic
971501783 4:27326167-27326189 GAAGCCACTCTGACTTTTAGAGG + Intergenic
974580854 4:63799395-63799417 AAAGTCACAAACACTTTCAGTGG + Intergenic
977920600 4:102638454-102638476 CAAGACACTCAAACTCTAAGTGG - Intronic
982392320 4:154878138-154878160 CAAGCCACTAAGATTTTCAGAGG + Intergenic
983115672 4:163813150-163813172 CTTGCCACTGACACTTCCAGTGG + Intronic
983160229 4:164404037-164404059 CTAGCTATTGACACTTTCAGAGG - Intergenic
984526283 4:180862451-180862473 CAACCCATTCCCATTTTCAGTGG - Intergenic
985540690 5:486143-486165 CAAACCACAGGCACTTTCAGAGG + Intronic
986245359 5:6002112-6002134 TAAGCAACTCAGACTTGCAGAGG + Intergenic
987182809 5:15385177-15385199 CCAGCAGCTCACACTTCCAGGGG + Intergenic
987278474 5:16387791-16387813 TCAGCCTCTCACACCTTCAGTGG + Intergenic
989459575 5:41682100-41682122 CAAGCATCTCACTCTCTCAGTGG - Intergenic
995842855 5:116460744-116460766 AAACCCACCCAAACTTTCAGAGG + Intronic
997709652 5:135993185-135993207 CAAGCCCCACACACACTCAGGGG + Intergenic
999583000 5:153060396-153060418 AATGCCACTAACACTTTCAGGGG - Intergenic
1001991014 5:176115365-176115387 CATGACACTCACACTCTCTGTGG + Intronic
1002225858 5:177722775-177722797 CATGACACTCACACTCTCTGTGG - Intronic
1002267989 5:178048437-178048459 CATGACACTCACACTCTCTGTGG + Intronic
1003067124 6:2913229-2913251 CAAGGAACTGACACTGTCAGAGG - Intergenic
1003796754 6:9613656-9613678 AAAGTCACTCACACTTTTAAAGG - Intronic
1006435957 6:34026417-34026439 GAAGCCCCTAAGACTTTCAGAGG + Intronic
1007468641 6:42073654-42073676 CAAGCCACTCACTATTCCACAGG - Intronic
1008081774 6:47202787-47202809 CAAGCTGCTCACAATTTCAAGGG - Intergenic
1012770576 6:103428290-103428312 AAAGCAATTCACAGTTTCAGTGG + Intergenic
1014461357 6:121699567-121699589 CAAGCCACACACACATGCAATGG + Intergenic
1015516661 6:134089012-134089034 CATGTCACTCAAAATTTCAGAGG - Intergenic
1020064550 7:5177380-5177402 CAAGCCACACACACGTCCAGTGG + Intergenic
1022076084 7:26972538-26972560 GAAGCCCATCAGACTTTCAGCGG - Intronic
1023396025 7:39753005-39753027 CAAGCCACTTACACTTTGTGGGG - Intergenic
1024874414 7:54005425-54005447 CAAGCAACTCAAAATCTCAGTGG - Intergenic
1029919544 7:104248413-104248435 GAAGCCACTCAGACTAACAGTGG + Intergenic
1030366717 7:108655098-108655120 CAAACGACTCACAAGTTCAGTGG - Intergenic
1031175731 7:118346755-118346777 CAAGACATTCAAACATTCAGTGG - Intergenic
1032387388 7:131534119-131534141 CGAGCCACTCACACCTGCACAGG + Intronic
1036892633 8:12606647-12606669 CAAGCCACTTACCCTGTCTGAGG - Intergenic
1040858035 8:51970387-51970409 CAAGCCACACTCACTGGCAGGGG - Intergenic
1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG + Intergenic
1042404660 8:68390238-68390260 CAAGGCACTAACACATTAAGGGG - Intronic
1042641147 8:70936346-70936368 AAAGCCACTAACTCTTTCACAGG - Intergenic
1044385058 8:91578153-91578175 CAAGCCAATCACACTCTCCCAGG + Intergenic
1044602631 8:94020929-94020951 CAAGCTACTCATGCTTTCAGAGG - Intergenic
1045211950 8:100107912-100107934 GAAGCCCCTCAGACTATCAGCGG + Intronic
1046503087 8:115103948-115103970 CAAGGGACTCAAACCTTCAGGGG - Intergenic
1047751925 8:127888299-127888321 AGAGCCACACACACTTGCAGCGG - Intergenic
1048426939 8:134331678-134331700 CAAGCCACTCCCTCTTACATGGG + Intergenic
1051375486 9:16398293-16398315 CAAGCCACTAAGATTTGCAGGGG - Intergenic
1051509866 9:17865835-17865857 CAATCCTCTAACACTTTCAGAGG + Intergenic
1054869922 9:70039793-70039815 CTATTCACTCACAGTTTCAGAGG + Intergenic
1055390761 9:75820116-75820138 GAAGCCAATCACACTAACAGTGG - Intergenic
1058170214 9:101671081-101671103 CTAGCCAATACCACTTTCAGAGG - Exonic
1186636903 X:11415934-11415956 CAAGCTACTCTGACATTCAGTGG - Intronic
1188662832 X:32780833-32780855 ACAGGCACTCGCACTTTCAGAGG + Intronic
1188977097 X:36688901-36688923 CAACACACACACACTTTTAGGGG + Intergenic
1189453040 X:41157352-41157374 CAAGCCACACAGACATGCAGTGG + Intronic
1192206003 X:69096841-69096863 CTAGGCACTCTCACTTTTAGAGG - Intergenic
1192437439 X:71151687-71151709 CAACCCAGGAACACTTTCAGAGG + Intronic
1198439774 X:136651887-136651909 CAAGCCACTCTCACTGCCATTGG - Intronic
1201064825 Y:10087958-10087980 CAACACAGTCACTCTTTCAGGGG - Intergenic
1201603460 Y:15758247-15758269 CAATCCATTCTCTCTTTCAGTGG + Intergenic