ID: 1078067771

View in Genome Browser
Species Human (GRCh38)
Location 11:8089461-8089483
Sequence CCCACATGGTAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1233
Summary {0: 1, 1: 0, 2: 16, 3: 219, 4: 997}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078067771_1078067777 5 Left 1078067771 11:8089461-8089483 CCTTCCTCCTTCTACCATGTGGG 0: 1
1: 0
2: 16
3: 219
4: 997
Right 1078067777 11:8089489-8089511 TGAGTCCCAGCAGCCGTGATGGG 0: 1
1: 0
2: 0
3: 14
4: 131
1078067771_1078067778 9 Left 1078067771 11:8089461-8089483 CCTTCCTCCTTCTACCATGTGGG 0: 1
1: 0
2: 16
3: 219
4: 997
Right 1078067778 11:8089493-8089515 TCCCAGCAGCCGTGATGGGATGG 0: 1
1: 0
2: 0
3: 16
4: 213
1078067771_1078067776 4 Left 1078067771 11:8089461-8089483 CCTTCCTCCTTCTACCATGTGGG 0: 1
1: 0
2: 16
3: 219
4: 997
Right 1078067776 11:8089488-8089510 CTGAGTCCCAGCAGCCGTGATGG 0: 1
1: 0
2: 1
3: 18
4: 179
1078067771_1078067784 19 Left 1078067771 11:8089461-8089483 CCTTCCTCCTTCTACCATGTGGG 0: 1
1: 0
2: 16
3: 219
4: 997
Right 1078067784 11:8089503-8089525 CGTGATGGGATGGGTTTAACGGG 0: 1
1: 0
2: 0
3: 9
4: 319
1078067771_1078067780 10 Left 1078067771 11:8089461-8089483 CCTTCCTCCTTCTACCATGTGGG 0: 1
1: 0
2: 16
3: 219
4: 997
Right 1078067780 11:8089494-8089516 CCCAGCAGCCGTGATGGGATGGG 0: 1
1: 0
2: 1
3: 12
4: 245
1078067771_1078067783 18 Left 1078067771 11:8089461-8089483 CCTTCCTCCTTCTACCATGTGGG 0: 1
1: 0
2: 16
3: 219
4: 997
Right 1078067783 11:8089502-8089524 CCGTGATGGGATGGGTTTAACGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078067771 Original CRISPR CCCACATGGTAGAAGGAGGA AGG (reversed) Intronic
900131567 1:1089464-1089486 CACGCAGGGTAGGAGGAGGAGGG - Intronic
900340868 1:2188491-2188513 CCCCCACGGTAGAAGGAGCAAGG + Intronic
900664970 1:3809045-3809067 CTCACAGGGTGGAAGGTGGAGGG + Intergenic
900728678 1:4236527-4236549 CTCACATGGTGGAAGCAGTAGGG - Intergenic
900874176 1:5329803-5329825 CTCACATGGTGGAAGGGGAAGGG + Intergenic
901291390 1:8126921-8126943 CCCACATGGTGGAAGGGGCGAGG - Intergenic
901780038 1:11587911-11587933 CAATCATGGTAGAAGGCGGAGGG - Intergenic
901932811 1:12607528-12607550 CCATCATGGCAGAAGGAGAAGGG - Intronic
902049301 1:13549280-13549302 CTCACAGGGTAGAGGGTGGAAGG + Intergenic
903388730 1:22948138-22948160 CTCACATGGTGGAAGGCAGAAGG - Intergenic
903538542 1:24083294-24083316 CCAACATGGAAGAAAGATGAAGG - Intronic
903925347 1:26827329-26827351 CCCAAATGGACCAAGGAGGATGG - Intronic
904029339 1:27524118-27524140 CCCTCATGGGAAAAGGAGGGAGG + Intergenic
905082146 1:35333005-35333027 CCCACATCTTAATAGGAGGAGGG + Intronic
905110762 1:35592809-35592831 CTCACATTGTAGAAGGGAGAAGG + Intronic
905268811 1:36773263-36773285 TCCACATTGTGGAAGGCGGAAGG + Intergenic
906068707 1:43001804-43001826 CTTACATGGTAGAAGGGGCAAGG + Intergenic
906441036 1:45844934-45844956 CTCACGTGGCAGAAGGTGGAAGG + Intronic
906730040 1:48072925-48072947 CTCACATGGTGGAAGGCAGAAGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907469044 1:54660234-54660256 CCTACATGGTGGTAGGTGGAAGG + Intronic
907706257 1:56835069-56835091 CACAGATGGTAGAAGGAGCAAGG - Intergenic
907800221 1:57757457-57757479 GCCAGAAGCTAGAAGGAGGAAGG - Intronic
907877259 1:58503653-58503675 CTCACATGGTAGAAGGGGCAAGG - Intronic
908265248 1:62372343-62372365 GCCACATGGTAGAAGGTTTATGG - Intergenic
908499472 1:64728903-64728925 CTCACATGGCAGAAGGTGGAAGG - Intergenic
908554636 1:65245559-65245581 CTCACATGGTGGAAGGGGAAAGG + Intergenic
908900818 1:68954534-68954556 CTTACATGGTAGAAGAAGCAAGG + Intergenic
908905686 1:69006201-69006223 CTCACATGGTGGAAGGAGAAAGG + Intergenic
908905857 1:69007939-69007961 CTCACATGGTGGAAGGGGAAAGG + Intergenic
909107694 1:71433115-71433137 CTCACATGGCAGAAGGCAGAAGG - Intronic
909198324 1:72655769-72655791 CTCACATGGTGGAAGGGGCAAGG - Intergenic
909454680 1:75837167-75837189 TTCACATGGTAGAAGGGGCAAGG - Intronic
909592934 1:77371863-77371885 CCATCATGGGAGAAGGAAGAGGG + Intronic
909878834 1:80847472-80847494 CTCACATGGCAGAAGGCAGAAGG + Intergenic
910191084 1:84596520-84596542 CTCACATGGCAGAAGGCTGAAGG + Intergenic
910359585 1:86402427-86402449 CCCACATGGTAGAGAGAGGAGGG + Intergenic
910399083 1:86820697-86820719 CTCACATGGCAGAAGTAGGTGGG + Intergenic
910544645 1:88400117-88400139 CTCACATGGTAGAAGGGGCAAGG + Intergenic
910739323 1:90497515-90497537 CCCATATGGTAAAAGTAGGATGG + Intergenic
911111651 1:94194593-94194615 CTCACATGATAGAAGGGGAAGGG + Intronic
911381904 1:97125731-97125753 TTCACATGGTAGAAAGAGGAAGG - Intronic
911500934 1:98683564-98683586 CTCACATGGTAAAAGGGGGGAGG - Intronic
911841210 1:102684760-102684782 CTCACATGGTGGAAGAAGCAGGG - Intergenic
912269712 1:108196728-108196750 CTCACATGGTGGAAGGGGCAAGG + Intronic
912307649 1:108586548-108586570 CCCACATGGTAAAAAGAGGAGGG - Intronic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912667611 1:111596743-111596765 CTCACATGGTAGAAGGGGTGAGG + Intronic
912908722 1:113734826-113734848 CTCACATGGTGGAAGGGGCAAGG - Intronic
913050288 1:115111657-115111679 CTCACATGGTAGAAGGGGAAGGG - Intergenic
913144083 1:115972275-115972297 CTCACATGGCAGAAGGTGGAAGG + Intergenic
913168180 1:116208735-116208757 CTCATATGGAAGAAGAAGGAAGG + Intergenic
913346322 1:117814443-117814465 CTCACATGGTGGAAGGGGCAAGG - Intergenic
914172403 1:145237613-145237635 CTCACATGGTGGAAGGGGCAAGG + Intergenic
914384157 1:147151381-147151403 CTTACATGGTAGAAGGCAGAGGG + Intergenic
914395309 1:147261334-147261356 CTCACATGACAGAAGGTGGACGG + Intronic
915102104 1:153508028-153508050 CTCACTTGGTTGAAGGGGGAAGG - Intergenic
915238148 1:154501300-154501322 CCCAAATGGTGGAGGGAGAAAGG + Intronic
916086136 1:161270909-161270931 CTCACATGGTAGAAGGGGAGAGG - Intronic
916247592 1:162704630-162704652 CTCACATGGTAGAAGCAGTGAGG + Intronic
916816978 1:168363676-168363698 CTCACATGGCAGAAGGTGGGAGG - Intergenic
916882595 1:169034361-169034383 CTCACATGGGAGAAGGGGAAAGG + Intergenic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917246990 1:173014162-173014184 CTCACATGGCAGAAGGCAGAAGG - Intergenic
917421655 1:174869815-174869837 CTTACATGGTAGAATGAGGAAGG - Intronic
918025494 1:180740893-180740915 CTCACATGGTAAAAGGGGCATGG + Intronic
918119647 1:181527262-181527284 CTCACATGGTAGAAGGGGTGAGG + Intronic
918208375 1:182329159-182329181 CCATCATGGTGGAAGGTGGAAGG + Intergenic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
918961138 1:191279689-191279711 CTCACATGGCAGAAGGTGGAAGG + Intergenic
919109357 1:193198418-193198440 TTCACATGGTGGAAGGTGGAAGG - Intronic
919330294 1:196162630-196162652 ACCATATTGTAGAAGGTGGATGG - Intergenic
919413604 1:197278249-197278271 CTCACATGGTGGAAGGAGTAAGG - Intronic
919418167 1:197337176-197337198 CTCACATGGTAGAAGGGGTGAGG - Intronic
920831790 1:209472133-209472155 CTCACATGGTAGAGGGAATAAGG + Intergenic
920945907 1:210528291-210528313 CCCCTGTGGTAGAAGGAGCAGGG + Intronic
921686464 1:218094749-218094771 CTCACATGGTAGAAGGGGCAAGG - Intergenic
921808399 1:219481697-219481719 CCTACCTGGAAGAAGGGGGAAGG - Intergenic
922253929 1:223875063-223875085 CTCACATGGTAGAAAGCAGAAGG - Intergenic
922332598 1:224590564-224590586 ATCACATGGCAGAAGGTGGAAGG + Intronic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
923315908 1:232779872-232779894 CTCACATGGTAGAAAGGGCAAGG + Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923476881 1:234342311-234342333 CTCACATGGTGGCAGGAGCAAGG - Intergenic
923626235 1:235616133-235616155 CCCACATAGCAGCAGGCGGAAGG - Intronic
923676857 1:236087876-236087898 CTCACATGGCAGAAGGTGGAAGG + Intergenic
923899721 1:238312401-238312423 CTCACATGGTGGAAGGGGCAAGG + Intergenic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
924272681 1:242350079-242350101 CCCACATGATAGAAGGGGCAAGG - Intronic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
924798938 1:247313084-247313106 CTCACATGGTGGAAGGGGCAAGG + Intronic
1063009736 10:2010939-2010961 CCCAAATGGCAGAAGTGGGAAGG + Intergenic
1063168784 10:3487262-3487284 CTCACATGGTGGAAGGAGTGAGG - Intergenic
1063419272 10:5898303-5898325 CTCACATGGTGGCAGGAGTAAGG + Intronic
1063493450 10:6486137-6486159 GCCACATGCTGGAAGGAAGAAGG + Exonic
1063942805 10:11147964-11147986 GCCACAGGGCAGAATGAGGAAGG + Intronic
1064328193 10:14370373-14370395 CTCACATGGTGGAAGGCAGAAGG - Intronic
1065245486 10:23752038-23752060 CCCTCATGTTAGAGGGAAGATGG + Intronic
1065327462 10:24561474-24561496 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1065385338 10:25128211-25128233 CACTCATGGTAGAAGGTGGAGGG - Intergenic
1065460344 10:25956077-25956099 CTCACATGGCAGAAGGCAGAAGG + Intronic
1065648902 10:27866644-27866666 CACTCATGGTAGAAGGTGAAAGG + Intronic
1065650189 10:27880658-27880680 CTCACATGGCAGAATGGGGAAGG - Intronic
1065663435 10:28030980-28031002 CTCACATGGTTGATGGTGGAAGG - Intergenic
1066136296 10:32449853-32449875 CTCACATGATGGAAGGAGCAAGG - Intronic
1066179719 10:32948704-32948726 ATCCCATGGTAGAAGGTGGAAGG - Intronic
1066208000 10:33208591-33208613 TCCAAATGGGAGAAGGCGGAGGG + Intronic
1066250092 10:33624857-33624879 CACCCATGGTAGAAGGTGAAGGG + Intergenic
1066539384 10:36428875-36428897 CTCACATGGTGGAAGAAGCAAGG - Intergenic
1066630026 10:37450145-37450167 CTCACATGGCAGAAGGCTGAAGG + Intergenic
1066680105 10:37929944-37929966 CTCACATGATAGAAGGGGCAAGG + Intergenic
1066712030 10:38246548-38246570 CCCACATGATAGAAGGGGCAAGG + Intergenic
1067141674 10:43663065-43663087 CCCTCATGGCAGAAGGTGAAGGG + Intergenic
1068118489 10:52760540-52760562 CTCACATGGTAGAAAGAGACTGG - Intergenic
1068293367 10:55033958-55033980 CTCACATGATAGAAGGTGAAGGG - Intronic
1068524778 10:58116087-58116109 CTCACATGGTAAAAGGGGCAAGG + Intergenic
1068590796 10:58851014-58851036 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1068766645 10:60771806-60771828 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1068786995 10:60987564-60987586 CCTACATGGGAGATGGAGGATGG - Intronic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1069036990 10:63656025-63656047 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1069279369 10:66635479-66635501 CTCACATGGCAGAAAGAGAAGGG + Intronic
1069747551 10:70725566-70725588 CTCACATGGTAGAAGGAGTGAGG + Intronic
1070532472 10:77349243-77349265 CTCACATGGTGGAAGGGGCAAGG - Intronic
1070578841 10:77703397-77703419 ACCACATGGCAGAAGGTGGGAGG - Intergenic
1070818377 10:79339644-79339666 CCCTCATGGTTGGAGGAAGAAGG - Intergenic
1071161594 10:82752751-82752773 CTCACATGGTGGAAGAAGCAAGG - Intronic
1071177238 10:82940723-82940745 CTCACATGGTAGAAGGGGCAGGG + Intronic
1071346214 10:84696419-84696441 GCCACAGGATGGAAGGAGGATGG + Intergenic
1071394570 10:85208912-85208934 CAATCATGGCAGAAGGAGGAAGG + Intergenic
1071549148 10:86552854-86552876 TTCACATGGTGGAAGGTGGAAGG - Intergenic
1071814213 10:89215400-89215422 CCCAAAGGGAAGAAGTAGGAGGG - Intronic
1072313611 10:94180809-94180831 CTCACATGGCAGAAGGTGAAAGG - Intronic
1072494666 10:95945026-95945048 CTCACATGGCAGATGGTGGAAGG - Intergenic
1072542998 10:96412715-96412737 CCCAAATGCTACAAGGTGGAGGG - Intronic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1073456802 10:103641787-103641809 CCCACATGGTAGGGCGAGGCAGG + Intronic
1073703726 10:105958954-105958976 CTCACATGTTGGAAGGAGCAAGG - Intergenic
1073940419 10:108691619-108691641 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1074079707 10:110157797-110157819 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1074270592 10:111949888-111949910 CTCACATGGTACAAGGGGTACGG - Intergenic
1074774849 10:116759939-116759961 CCCTCATGGTGGAAGGTGAAAGG - Intergenic
1074962789 10:118463276-118463298 CTCACGTGGTAGAAGGAGTGAGG - Intergenic
1075098260 10:119487917-119487939 CTCACATGGTAGAAGGGGTGAGG - Intergenic
1075350960 10:121724988-121725010 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1075976621 10:126701680-126701702 GCCACAGTGTAGAAAGAGGAGGG - Intergenic
1075989040 10:126817292-126817314 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1075990593 10:126835478-126835500 TCCACATGGTAGAAGAGGGTGGG + Intergenic
1076130940 10:128013505-128013527 GTCACATGGTAGACAGAGGAGGG + Intronic
1076559918 10:131355435-131355457 TCCAAATGGCAGAAGGAGCATGG - Intergenic
1077511064 11:2963404-2963426 CCCACATGGGGCAAGGAAGATGG + Intronic
1077716536 11:4586927-4586949 CCCACAAGGAGGAAGGAGGCAGG - Exonic
1077717228 11:4594075-4594097 CCCACAAGGAGGAAGGAGGCAGG - Exonic
1078067771 11:8089461-8089483 CCCACATGGTAGAAGGAGGAAGG - Intronic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078514586 11:12010505-12010527 ACCGCATGGTAGAAGGTGTAAGG - Intergenic
1078890830 11:15557028-15557050 CTCACATGGTGGAAGGTGGAAGG - Intergenic
1079551269 11:21701452-21701474 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1079651385 11:22934317-22934339 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1079670576 11:23165306-23165328 CTCACATAGTAGAAGATGGAAGG + Intergenic
1079676881 11:23239516-23239538 CTCACATGGTGGAAGATGGAAGG + Intergenic
1080095763 11:28404472-28404494 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1080195483 11:29603624-29603646 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1080232729 11:30035729-30035751 CTCATATGGCAGTAGGAGGAAGG - Intergenic
1080308887 11:30866937-30866959 CCCACAGGGCAGAAAGTGGAAGG - Intronic
1080392119 11:31857991-31858013 CTCACATGGTAGAAGAGGCATGG - Intronic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080762843 11:35269140-35269162 CTCACATGGTAGAAGGGCCAAGG - Intronic
1080830950 11:35892814-35892836 TCCACATGGCAGAAAGAGGGAGG - Intergenic
1080942376 11:36933973-36933995 CTCACATGGTTGAAGGGGCAAGG + Intergenic
1081059485 11:38455644-38455666 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1081337081 11:41880068-41880090 CTCACATGGTGGAAGGTGGAAGG - Intergenic
1081394472 11:42569476-42569498 CCCACATGGCAGAAGGCAGAAGG + Intergenic
1081529294 11:43947115-43947137 CACTCATGGTGGAAGGTGGAGGG + Intergenic
1082990227 11:59201150-59201172 CCCACATGGTAGAAGGGGCAAGG + Intronic
1082997683 11:59266431-59266453 GCCACATGGTGGGAGGATGAAGG - Intergenic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1084164933 11:67371172-67371194 CCCAGAGGGTGGAAGGAAGATGG - Intronic
1084451721 11:69242938-69242960 CCCACATGTGAGAAGGAGGTGGG + Intergenic
1084601181 11:70146826-70146848 CCAACATGGGAGAAAGATGAAGG + Intronic
1084976406 11:72801634-72801656 CCCACATGGTAGAAGAGGCCTGG - Intergenic
1085110915 11:73887010-73887032 CACTCATGGCAGAAGGAGAAGGG - Intronic
1085532511 11:77200349-77200371 CACTCATGGCAGAAGGAGAAGGG + Intronic
1085783882 11:79434670-79434692 CCCAGGTGGTAGAAGAAGGCAGG - Intronic
1085971049 11:81590916-81590938 CACTCATGGTAGAAGGTGAAGGG + Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086790426 11:91030726-91030748 CTCACATGGTGGAAGGTGGAAGG - Intergenic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087369466 11:97264093-97264115 CTCACATGGCAAAAGGTGGAAGG + Intergenic
1087401765 11:97675866-97675888 CTAACATGGCAGAAGGTGGAAGG + Intergenic
1087512458 11:99115002-99115024 CTCACATGGAAGAAGGGGGAAGG - Intronic
1087673662 11:101134248-101134270 CTCACATGGTAGAAGGGGCAGGG - Intergenic
1087917537 11:103828642-103828664 ATCACATGGTGAAAGGAGGAAGG - Intergenic
1088338552 11:108736703-108736725 CTCACATGGCAGAAGGCAGAGGG - Intronic
1088363816 11:109018240-109018262 ACAACATGGTAGAAGGAGCAGGG + Intergenic
1088468371 11:110165894-110165916 CCCACATGGTGGAAGTATCACGG + Exonic
1088715163 11:112542721-112542743 CCCACCAGGAAGAGGGAGGAAGG + Intergenic
1089061475 11:115629533-115629555 CCCACAAGCTAGCAGGAGGGTGG + Intergenic
1089238748 11:117055847-117055869 CTCACATGGCAGAAGGCAGAAGG - Intronic
1089420536 11:118330094-118330116 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1089766467 11:120770820-120770842 ATCACATGGTAGAAAGAGCAAGG - Intronic
1090332055 11:125940011-125940033 CCCACATAGTGGAAGGCAGAAGG - Intergenic
1090348972 11:126094795-126094817 CCAGCATGGGAGAAGGATGAAGG - Intergenic
1090374476 11:126279287-126279309 CTCACATGGCAGAAGGGGTAAGG + Intergenic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1090670180 11:128940507-128940529 CTCACATGGCTGAAGGTGGAAGG - Intronic
1091233112 11:134001071-134001093 CCCACCTGGTAAGAGGGGGAAGG - Intergenic
1091521590 12:1249859-1249881 CTCACATGGTGGAAGGGGCAAGG + Intronic
1091900632 12:4141282-4141304 CCCACCAGGAAGCAGGAGGATGG - Intergenic
1091958262 12:4667115-4667137 CTCACATGGTGGAAGGTGGAAGG + Intronic
1092288243 12:7142382-7142404 TCCACATGGTAGAAGGGAGGTGG + Intronic
1092361470 12:7840189-7840211 CTCACATGGTGGAAGGCAGAAGG - Intronic
1092565881 12:9664991-9665013 CTCACATAGTAGAAGGAACAAGG - Intronic
1092908303 12:13122519-13122541 ACCACATGGTGGAAGGAGTGAGG + Intronic
1092976177 12:13746875-13746897 CACTCATGGTGGAAGGTGGAGGG - Intronic
1092977080 12:13755883-13755905 CTCACAGGGTGGAAGGAGCAAGG - Intronic
1093195184 12:16122148-16122170 CTCACATGGTGGAAGGAGGAAGG + Intergenic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1093823640 12:23653685-23653707 CTCACACTGTAGAAGGAGCAAGG + Intronic
1094126951 12:27033307-27033329 CTCACATGGTAGAAGAAGCAAGG + Intronic
1095039465 12:37425390-37425412 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1095126314 12:38482121-38482143 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1096768822 12:53918816-53918838 ATCACATGGCAGAAGGTGGAAGG + Intergenic
1097056387 12:56252433-56252455 AACAAATGGTAGAGGGAGGAAGG - Intronic
1097325556 12:58272425-58272447 CTCACATGGCAGTAGGTGGAAGG + Intergenic
1097574136 12:61370154-61370176 CTCACATGGCAGAAGGTGGATGG - Intergenic
1097689732 12:62723575-62723597 TTCACATGGCAGAAGGTGGAAGG - Intronic
1098034656 12:66289533-66289555 CCCAAATGGAAGAACAAGGATGG - Intergenic
1098235521 12:68414540-68414562 CTCACATGGTGGAAGGGGAAAGG - Intergenic
1098385501 12:69914648-69914670 CTCTCCTGGAAGAAGGAGGATGG - Intronic
1098854010 12:75631754-75631776 CTCACATGGTAAAAGGCAGAAGG + Intergenic
1099242368 12:80153273-80153295 CTCAGATGGTGGAAGGAGCAAGG + Intergenic
1099303001 12:80921148-80921170 CTCACGTGGTAGAAGGGGCAAGG - Intronic
1099339466 12:81410065-81410087 CTCACATGGCAGAAGGTGGCTGG - Intronic
1099438489 12:82671104-82671126 CCCACATGATGGAAGGGGCAAGG - Intergenic
1099449872 12:82795685-82795707 TCCACATGGTGGAAGGCAGAAGG - Intronic
1099482310 12:83183253-83183275 CTCACATGGTAGAAAGGGCAAGG + Intergenic
1099598204 12:84696250-84696272 TCCACATGGTAGAAGGGTGAGGG + Intergenic
1100121315 12:91372555-91372577 CCCACATGGTGGAAGGGAGTTGG + Intergenic
1100121689 12:91375852-91375874 CTCACCTGGCAGAAGGATGAGGG + Intergenic
1100270153 12:93016867-93016889 CTCACATGCTAGAAGAAGCAGGG - Intergenic
1100638866 12:96461912-96461934 CACTCATGGTAGAAGGTGAAGGG + Intergenic
1100752192 12:97710590-97710612 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1100806303 12:98287498-98287520 CCCACATGGCAGAAGGGGCAAGG - Intergenic
1101049122 12:100842732-100842754 CTTACATGGTAGAAGGTGGAAGG + Intronic
1101317257 12:103640756-103640778 CTCACATGATAGAAAGAAGATGG + Intronic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1102879494 12:116473512-116473534 CTCACATGGAAGAAGGTGAAAGG - Intergenic
1103076404 12:117986309-117986331 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1103266061 12:119631283-119631305 CCCAGATGGGTGAGGGAGGAAGG + Intronic
1103966449 12:124642957-124642979 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1104546111 12:129714262-129714284 GGCATATGGCAGAAGGAGGAAGG - Intronic
1105289785 13:19045421-19045443 CCAGCATGGGAGAAGGATGAAGG + Intergenic
1105478402 13:20749306-20749328 TCTACATTGTAGTAGGAGGATGG - Intronic
1105697931 13:22908919-22908941 CTCACATGGAAGAAGGTGGAAGG + Intergenic
1106017226 13:25881174-25881196 CACACTTGGTAGAATGTGGAAGG + Intronic
1106319582 13:28625058-28625080 CCCACCTGGAAGAAGGAGAAAGG + Intergenic
1106345461 13:28872561-28872583 TCCACATGGTGGAAGGTGAAGGG + Intronic
1106782725 13:33075894-33075916 CTCACATGGTAGAAGGTAGAGGG + Intergenic
1107360564 13:39613261-39613283 CTCACATGGCAGAAGGAGCGAGG + Intergenic
1107400821 13:40067304-40067326 CTCACATGGTGGAAGGTGAAAGG - Intergenic
1107634105 13:42374605-42374627 CTCACATGGAGGAAGGCGGAAGG + Intergenic
1107791177 13:44003854-44003876 CTCACATAGTGGAAGGAGGAAGG - Intergenic
1108017343 13:46089722-46089744 TTCACATGGTGGAAGGGGGAGGG - Intronic
1108055215 13:46478502-46478524 CTCACATGGTGGAAGGTGGAAGG - Intergenic
1108161463 13:47644717-47644739 CTCATATGGTGGAAGGAGGAAGG - Intergenic
1108825281 13:54406268-54406290 CTCACATGGTAGAAGCAGCAAGG + Intergenic
1109107805 13:58277271-58277293 CACTCATGGTAGAAGGTGAAAGG + Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109330008 13:60917917-60917939 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1109330231 13:60919919-60919941 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1109629787 13:65031835-65031857 CTTACATGGTGGCAGGAGGAAGG + Intergenic
1109642489 13:65208874-65208896 CACTCATGGTAGAAGGTGAAGGG - Intergenic
1109995256 13:70115210-70115232 CACACATAGTAGAAGGCAGAAGG + Intergenic
1110237038 13:73227806-73227828 ACATCATGGTAGAAGGTGGAAGG + Intergenic
1110285054 13:73740236-73740258 TTCACATGGTAGAAGGAGCAAGG - Intronic
1110313349 13:74076479-74076501 CCCACACAGTGGAAGGTGGAAGG + Intronic
1110399944 13:75078496-75078518 CACAGATGGTAGAAGTATGAGGG - Intergenic
1110670862 13:78175917-78175939 CCCACGTGGCAGAAAGTGGAAGG + Intergenic
1110823739 13:79947266-79947288 CTAACATGGTAGAAGGTGGAAGG - Intergenic
1111511864 13:89276927-89276949 ACCAGATGGTGGAAGGAGTAAGG - Intergenic
1111641484 13:90976279-90976301 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1111686435 13:91507239-91507261 ATCACATGGCAGAATGAGGAAGG + Intronic
1112028920 13:95439294-95439316 CTCACATGGTGGAAGGGGCAAGG + Intronic
1112248351 13:97754821-97754843 CCCACCTGGCAGAAGGTGGAGGG + Intergenic
1112251466 13:97784464-97784486 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1112523747 13:100122881-100122903 CTCACATGGTGGAAGGAGCAAGG + Intronic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1112910710 13:104480030-104480052 TCCCCATGTTAGATGGAGGAAGG - Intergenic
1112971574 13:105269245-105269267 CAATCATGGTAGAAGGTGGAAGG - Intergenic
1113031001 13:105993494-105993516 CTCACATGGTGGAAGGAGTGAGG + Intergenic
1113389089 13:109878506-109878528 CGCACATGGTAGAAGGGCAAGGG - Intergenic
1113492573 13:110703996-110704018 CTCACATGGTAGAAGGTAGAGGG - Intronic
1113501542 13:110779362-110779384 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1113933437 13:113980813-113980835 CCCGCATGGTGGAAGGAAGGAGG + Intronic
1114584532 14:23798272-23798294 CTCACATGGAAGAAGGTGGAAGG - Intergenic
1114663540 14:24366155-24366177 TCCAGATGCTAGGAGGAGGAGGG + Intronic
1114731291 14:24995191-24995213 CTCACATGGTAGAAGGAACAAGG + Intronic
1115122205 14:29951068-29951090 CTTACATGGTAGCAGGAGGGTGG - Intronic
1115300199 14:31876888-31876910 CCCACATGGCAGAAGGCGAAGGG + Intergenic
1116122690 14:40741003-40741025 CCCGCATGGGAGAAAGATGAAGG + Intergenic
1117679204 14:58185832-58185854 CTCACATGGTGGAAGGGGCAAGG - Intronic
1118050891 14:62026429-62026451 CTCACATGGCAGAAGGTGGAAGG + Intronic
1118172994 14:63407848-63407870 CTCACATGGTGGAAGGCAGAAGG - Intronic
1118226653 14:63906922-63906944 CTCACATGGTAGAACGGGTAAGG + Intronic
1118620289 14:67608789-67608811 CTCACATGGTACAAGGGGCAAGG + Intergenic
1118849018 14:69570790-69570812 GCCACTTGGTAGAATGAGGGAGG + Exonic
1118998925 14:70863214-70863236 CAATCATGGCAGAAGGAGGAGGG + Intergenic
1119432036 14:74574848-74574870 CTCAAATGGGAGAAGGGGGAAGG + Intronic
1119609134 14:76047009-76047031 CTCACATGGCAGAAGGCAGAAGG + Intronic
1119911472 14:78353439-78353461 CTCACATGGTGGAAGGGGCAAGG + Intronic
1119925706 14:78491322-78491344 GCCACATGGTAGTGGCAGGAAGG - Intronic
1119991950 14:79208019-79208041 CCCAGAGGGTATAAAGAGGAAGG + Intronic
1120377307 14:83726476-83726498 CCCACATGGAAGGAGATGGAAGG - Intergenic
1120413158 14:84184067-84184089 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1120508967 14:85389496-85389518 CTCCCATGGTGGAAGGTGGAAGG + Intergenic
1120566721 14:86068762-86068784 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1121220649 14:92282620-92282642 ATCACATGGCAGAAGGTGGAAGG - Intergenic
1121303546 14:92890513-92890535 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1121424241 14:93837107-93837129 CTCACATGGCAGCAGGAGCAAGG + Intergenic
1121860873 14:97316844-97316866 TCCTCATGTTAAAAGGAGGATGG - Intergenic
1121960885 14:98258351-98258373 CTCACTTGGCAGAAGGTGGAGGG + Intergenic
1122115672 14:99526153-99526175 CCCACAGGCCAGAAGCAGGAGGG - Intronic
1122304713 14:100755620-100755642 CCCCAATGGTAGTAGGAGGTGGG - Intergenic
1122533427 14:102445217-102445239 CCCATATGGAAGGAGGGGGAGGG + Intronic
1123540054 15:21280943-21280965 CTCACATGGCATAAGGTGGAAGG - Intergenic
1123971485 15:25511849-25511871 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1124498072 15:30199909-30199931 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1124572581 15:30878659-30878681 CACACATGGTGGAAGGGGCAAGG - Intergenic
1124745510 15:32338761-32338783 CTCACATGGTAGAAGGCAGAAGG - Intergenic
1124839542 15:33229021-33229043 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1125091924 15:35802885-35802907 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1125298259 15:38226048-38226070 CTCACATAGTAGAAGGTGGAAGG - Intergenic
1125772598 15:42179996-42180018 TTCACATGGTGGAAGGAGAAGGG - Intronic
1126127920 15:45313149-45313171 CACTCATGGTAGAAGGTGAAAGG - Intergenic
1126243995 15:46481948-46481970 ATCACATGGTGGAAGGTGGAAGG - Intergenic
1126358738 15:47823584-47823606 CTCACATGGTGGAAGGGGTAAGG - Intergenic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127040135 15:54966158-54966180 TTCACATGATAGAAGGAGCAAGG + Intergenic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127783780 15:62338686-62338708 CTCACATGGTGGAAGGTAGAAGG + Intergenic
1127952538 15:63823483-63823505 CCTAACTGGTAGAAGGAAGAAGG + Intronic
1128591788 15:68904493-68904515 CTCACATGGCAGAAGGCAGAAGG + Intronic
1128781887 15:70364156-70364178 CACTCATGGTAGAAGGAGAAAGG + Intergenic
1128787949 15:70412207-70412229 AACACATGGTGGAAGGAGGCAGG - Intergenic
1129056259 15:72822554-72822576 CTCACTTGGTGGAAGAAGGAAGG + Intergenic
1129279963 15:74476906-74476928 CCAACATGGCAGAAGGTGAAAGG + Intergenic
1129429229 15:75486393-75486415 CTCACATGGCAGAAGGGGAAGGG - Intronic
1129485663 15:75869585-75869607 CTCACATGGTAGAAGGCAGAAGG + Intronic
1130265759 15:82401595-82401617 CTCACATGGTAGCAGGCAGAAGG + Intergenic
1130506256 15:84545320-84545342 CTCACATGGTAGCAGGCAGAAGG - Intergenic
1130685545 15:86033900-86033922 CTCACATGGTGGAAGGAAGAAGG + Intergenic
1131334615 15:91536086-91536108 CTACCATGGTAGAAGGAGCAAGG - Intergenic
1131345175 15:91640161-91640183 CTCACATGGTGGAAGGGTGAGGG + Intergenic
1131373298 15:91902556-91902578 CCTACATGGGAGTAGGAGGGAGG + Intronic
1131539954 15:93267663-93267685 CTCACATGGTAGAGGGAACAAGG + Intergenic
1131560743 15:93437243-93437265 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1131668581 15:94595984-94596006 CATACATGGAAGAAGGAGGGGGG - Intergenic
1131780098 15:95846683-95846705 CCATCATGGTAGAATGGGGACGG + Intergenic
1131975287 15:97939752-97939774 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1132341225 15:101079586-101079608 CCCACAAGGAAGGAGGAGGCAGG - Intergenic
1202948365 15_KI270727v1_random:8101-8123 CTCACATGGCATAAGGTGGAAGG - Intergenic
1132703065 16:1230172-1230194 CCCACTGGGTAGAAGGAACAGGG - Exonic
1132705257 16:1240696-1240718 CCCACTGGGTAGAAGGAACAGGG + Exonic
1133025580 16:2987712-2987734 CCCTCATGGAAGGAGGAGGGAGG + Intergenic
1133441145 16:5821824-5821846 CTCACATGGTGAAAGGAGAAGGG + Intergenic
1133663711 16:7944438-7944460 CTCACATGGTGAAAGGCGGAAGG - Intergenic
1133893325 16:9902412-9902434 GCCACAGGGTAGAAGGAGCCTGG + Intronic
1134277715 16:12791624-12791646 CCCACCTGGGAGAAGGAGGCTGG + Intronic
1134285672 16:12860155-12860177 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1134568785 16:15274042-15274064 CCCAGATGGTATCAGAAGGAAGG + Intergenic
1134710919 16:16326614-16326636 TTCACATGAGAGAAGGAGGAGGG - Intergenic
1134733650 16:16482320-16482342 CCCAGATGGTATCAGAAGGAAGG - Intergenic
1134891207 16:17843250-17843272 TTCACATGGTGGAAGGAGCAAGG + Intergenic
1134908791 16:18005351-18005373 CCCACTTGGCAGAAAGAGGATGG + Intergenic
1134933852 16:18229962-18229984 CCCAGATGGTATCAGAAGGAAGG + Intergenic
1134948665 16:18341995-18342017 TTCACATGAGAGAAGGAGGAGGG + Intergenic
1135050795 16:19191395-19191417 CCCACATGGAGGAAGGGGCAAGG - Intronic
1135086840 16:19481910-19481932 CCCACGTGGTAGAAGGGGCAAGG - Intronic
1135846383 16:25922339-25922361 CTCACATGGTACAAAGAGCAAGG - Intronic
1135899461 16:26443528-26443550 TTCACATGGCAGAAGGTGGAGGG - Intergenic
1136390726 16:29962437-29962459 CCCACTTGGAAGCAGGAGGCGGG + Intronic
1136596375 16:31253055-31253077 CCCACTTGTTTGAAGGAGGTGGG + Intergenic
1137595159 16:49718739-49718761 CTCACATGGTGGAAGGAGCTGGG + Intronic
1137997549 16:53235187-53235209 TCCAAATATTAGAAGGAGGACGG - Exonic
1138233020 16:55353650-55353672 CTCACATGGTGGATGGAGGCAGG - Intergenic
1138397162 16:56713867-56713889 CTCACATGGCAGAAGGCAGAAGG + Intronic
1138693216 16:58788181-58788203 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1138730005 16:59184105-59184127 CTCACATGGTGGAAGGGTGAGGG + Intergenic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG + Intergenic
1139334646 16:66223291-66223313 CCCACTTAGTAGAAGGTGGTTGG - Intergenic
1139401827 16:66688118-66688140 CTCACATGGCAGAATGAGCAAGG + Intronic
1140059861 16:71559194-71559216 ACCACATGGCAGAAGGTGAAGGG - Intronic
1140066855 16:71618722-71618744 CTCACATGGTAAAAGGAGCAAGG - Intergenic
1140231090 16:73117826-73117848 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1140452052 16:75078965-75078987 CCAACATGGTAGCAGGAACATGG - Intronic
1140835985 16:78794172-78794194 CTCACATGGTGGAAGAAGCAAGG - Intronic
1140886559 16:79249456-79249478 CTCACATGGTGGAAGGGGCATGG - Intergenic
1141030037 16:80579627-80579649 CTCACATGATGGAAGGAGCAGGG - Intergenic
1141042422 16:80683774-80683796 CTCACATGATAGAAGGGGCAAGG - Intronic
1141284238 16:82656226-82656248 GGCACAGGGTAGAAGGAGAATGG + Intronic
1142004385 16:87682517-87682539 CTCACATGGTAGAAGAAGCGAGG - Intronic
1142157489 16:88539266-88539288 CCCTCCTGGAAGAAGGAGGGTGG - Intergenic
1142824088 17:2496837-2496859 CTCACAGGGTGGAAGGTGGAAGG - Intronic
1143265105 17:5630705-5630727 CCCCCAGGGAAGTAGGAGGAGGG + Intergenic
1143880708 17:10027583-10027605 CTCACATGGTGGAAGGCAGAAGG - Intronic
1144012157 17:11159429-11159451 CACTCATGGTGGAAGGAGAAAGG - Intergenic
1144243998 17:13345312-13345334 CTCACATGGGAGAAGGCTGAAGG + Intergenic
1144357794 17:14462412-14462434 CTCACATGGCAAAAGTAGGAGGG + Intergenic
1144671562 17:17135611-17135633 CTCACATGTTAGAAGGGGCAAGG + Intronic
1144938157 17:18916819-18916841 CTCAGATGGTGGAAGGAGCAAGG + Intronic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1145302760 17:21652763-21652785 CCCACAGGGAATAAGGAGCAGGG - Intergenic
1145347542 17:22050426-22050448 CCCACAGGGAATAAGGAGCAGGG + Intergenic
1145378408 17:22373047-22373069 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1145416038 17:22714903-22714925 CCCACAGGGAAAAAGGAGTAGGG - Intergenic
1145837530 17:27965863-27965885 CTCACATGGTGGAAGGGGCAGGG + Intergenic
1146309580 17:31756922-31756944 CCTACATGGTGGAAGGAGTCAGG - Intergenic
1147263938 17:39224172-39224194 TCAAGATGGAAGAAGGAGGAAGG + Intronic
1147624920 17:41893844-41893866 GCCACCTGGTAGAAGGGAGAAGG - Intronic
1148222096 17:45870221-45870243 CCCAGATGATAGGAGGAGGCAGG + Intergenic
1148534118 17:48424182-48424204 CTCACATAGTGGAAGGAGTAAGG + Intronic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1149506091 17:57195153-57195175 CCCACATGGGAGGTGGAGGTGGG - Intergenic
1149723585 17:58869538-58869560 CACCCATGGCAGAAGGAGAAGGG - Intronic
1150166462 17:62948208-62948230 TTCACATGGTAGAAGAAGTAAGG - Intergenic
1150285009 17:63949575-63949597 CCCATCTGGTAGGAGGATGAGGG - Intronic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1150998551 17:70347522-70347544 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1151532793 17:74717860-74717882 CTCACATGGTAGAAGGGGCAAGG - Intronic
1151971472 17:77459648-77459670 TCCTCATGGTAGAAGGTGAAGGG + Intronic
1151998930 17:77632585-77632607 CTCACATGGTAGAAGGGTGGGGG - Intergenic
1152029546 17:77833474-77833496 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1152033302 17:77856927-77856949 CCCACAAGGAGGAAGGAGGTGGG - Intergenic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1152372191 17:79895884-79895906 CTCACTTGGTGGAAGGTGGAAGG - Intergenic
1152410859 17:80122249-80122271 CCCACATGGGACTAGGATGAGGG - Intergenic
1152523145 17:80872302-80872324 TCCACATGGAACTAGGAGGATGG - Intronic
1153132861 18:1877382-1877404 CTCACATGACAGAAGGGGGAAGG - Intergenic
1153674809 18:7447470-7447492 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153967643 18:10196191-10196213 CTCACGTGGCAGAAGGAGCAAGG + Intergenic
1154938653 18:21088769-21088791 CTCACATGGTAGAAGGCAAAAGG - Intronic
1155021152 18:21898091-21898113 ACCACATGGTAGCATGAGGATGG - Intergenic
1155098987 18:22589997-22590019 GCCTCATGGTAGAAGGATGTGGG - Intergenic
1155631533 18:27899724-27899746 CCCACATGCTAGAAGGTGTGTGG - Intergenic
1155650922 18:28140540-28140562 CTCACATGGTAGAAGAGGCAAGG - Intronic
1155676016 18:28429816-28429838 CACACTTGTTAGAAGGAGCATGG + Intergenic
1155691576 18:28631060-28631082 TCCACATGGTGGAGGGTGGAGGG - Intergenic
1156017174 18:32559852-32559874 CCCACATGGCAGCAGCAGAAAGG + Intergenic
1156454108 18:37283205-37283227 ACCTCAGGGTAGAAGGAGGAGGG - Intronic
1156525975 18:37767742-37767764 CTCACATGGTGGAAGGAGTAAGG + Intergenic
1156708300 18:39911020-39911042 CTCACATGATAGAAAGAGCAAGG - Intergenic
1156886246 18:42139676-42139698 CTCACATGGCAGAAGCAGAAGGG + Intergenic
1157301748 18:46484431-46484453 CTCACATGGCAGAAGGCGGAGGG - Intronic
1157534491 18:48448364-48448386 CAGTCATGGTGGAAGGAGGAGGG - Intergenic
1157630158 18:49087042-49087064 TCCACATGGCAGAAGGGGTAAGG - Intronic
1157721019 18:49924542-49924564 CCCACAAGCTGGAAAGAGGAGGG + Intronic
1157786025 18:50483370-50483392 CTCACATGGTGGAAGGTGGGAGG - Intergenic
1157818869 18:50750941-50750963 CTCACATGGTGGAAGGAGCCAGG - Intergenic
1158013323 18:52754484-52754506 CTCACATGGTGAAAGGAGCAGGG - Intronic
1158094511 18:53755531-53755553 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1158334104 18:56395727-56395749 CTCACATGGCAGAAGATGGAAGG + Intergenic
1159215715 18:65387951-65387973 CAATCATGGTAGAAGGTGGAAGG - Intergenic
1159270377 18:66141556-66141578 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1159376337 18:67598305-67598327 CTCACATGGTGGAGAGAGGAAGG + Intergenic
1159488002 18:69091547-69091569 CTCACGTGGGAGAAGGTGGAAGG + Intergenic
1159628869 18:70726294-70726316 AACTCATGGTAGAAGGTGGAAGG + Intergenic
1159996988 18:74974674-74974696 CCCACATGGAAGTTGGGGGATGG + Intronic
1160144671 18:76353707-76353729 CACTCATGGTGGAAGGTGGAGGG - Intergenic
1160609910 18:80076891-80076913 CTCACGTGGTGGAAGGTGGAAGG + Intronic
1162286045 19:9739708-9739730 CCCGCATGGGAGAAAGAGGTAGG + Intergenic
1162434647 19:10650230-10650252 GCCAAATGGCAGAACGAGGATGG - Intergenic
1162863693 19:13527456-13527478 CCATCATGGTAGAAGGTGAAAGG + Intronic
1163339564 19:16696511-16696533 CCCACATGGTAGAAAGATCAAGG + Intergenic
1164474311 19:28563461-28563483 CCCACATGGTAGAGAGCAGAAGG + Intergenic
1164680738 19:30132223-30132245 CCCTGTTGGTACAAGGAGGAGGG - Intergenic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165642007 19:37397695-37397717 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1167097129 19:47380504-47380526 CTGACATGCTAGGAGGAGGAGGG + Intronic
1167168201 19:47813642-47813664 CCCACAAGGGACAACGAGGAGGG - Intronic
1168135798 19:54350506-54350528 TCCAAATAGGAGAAGGAGGAGGG + Intergenic
925496089 2:4450900-4450922 CTCACATGGCAGAAGGCTGAAGG - Intergenic
925880641 2:8349611-8349633 CTCACATGGCAGAAGGCAGAGGG + Intergenic
926041742 2:9679216-9679238 CTCACATGGTGGAAGGGGCAAGG - Intergenic
926041889 2:9680090-9680112 CTCACATGGTAGAAAGGGGAAGG + Intergenic
926452894 2:13027314-13027336 CTCACATGGTGGAAGGTGAAAGG + Intergenic
926996302 2:18739690-18739712 CTCACATGGAAGAAGGAGTGAGG - Intergenic
927466103 2:23337815-23337837 CTCACATGGTGGAAGGCAGAAGG - Intergenic
928079908 2:28301662-28301684 CCCATATGGGAGAAGGTTGAAGG - Intronic
928407811 2:31028341-31028363 CCGCCATGGTGGGAGGAGGAGGG - Intronic
928495923 2:31831915-31831937 CCCACATGGCTGAAGATGGAAGG + Intergenic
928717841 2:34083302-34083324 TTCACATGGGAGAAGGAAGAAGG + Intergenic
929059874 2:37913345-37913367 CCAGCATGGGAGAAAGAGGAAGG - Intergenic
929129035 2:38547962-38547984 CTCACATGGCAGAAGGAGCAGGG - Intergenic
929228119 2:39531630-39531652 CTCACATGGTGGAAGGGGGATGG + Intergenic
929335271 2:40736047-40736069 GTCACATGGCAGAAGGAGTAAGG - Intergenic
929346928 2:40895654-40895676 CTACCATGGTAGAAGGTGGAAGG + Intergenic
929712336 2:44277945-44277967 CCCACATTTTAGAAGGAGAGAGG - Intronic
929831125 2:45347351-45347373 CTCACATGGCAGAAGGAGCAAGG + Intergenic
929965561 2:46532656-46532678 CTCACATGGTAGAAGGGAAAAGG - Intronic
930239650 2:48922876-48922898 CTCACATGGCAGAAGCTGGAAGG + Intergenic
930253664 2:49064459-49064481 CTCACATGGTGGAAGGTGGAAGG - Intronic
930605945 2:53493172-53493194 CTCACATGGGAGAAGGGGCAAGG - Intergenic
930687677 2:54326487-54326509 CAATCATGGTAGAAGGTGGAGGG - Intergenic
931778353 2:65558918-65558940 CTCACACGGTGGAAGGCGGAAGG - Intergenic
932365601 2:71151098-71151120 CTCACTTGGCAGAAGGTGGAAGG + Intergenic
932439721 2:71726200-71726222 CCCACATGGATGAAGTATGAGGG - Intergenic
932897385 2:75654222-75654244 CTCACATGGTGAAAGGTGGAAGG + Intronic
933558169 2:83857759-83857781 CCCACATGGCAAAAGGCAGAAGG - Intergenic
933773647 2:85758990-85759012 CCCTCAGGGTTGATGGAGGATGG + Intronic
934096956 2:88615504-88615526 CCTACATGGTGGAAGGGGCAAGG - Intronic
934486146 2:94713203-94713225 CTCACATGGTGGAAGGTGGAAGG - Intergenic
934655569 2:96115374-96115396 TCCACTGGGGAGAAGGAGGAGGG - Exonic
934891439 2:98073891-98073913 CTCAGATGGCAGAAGGAGAAAGG + Intergenic
935272578 2:101447952-101447974 CTCACATGGCAGAAGGCAGAAGG + Intronic
935400544 2:102655864-102655886 CTCACATGGCAGAAGGCAGAGGG + Intronic
935708332 2:105875618-105875640 CTCACATGGCAGAAGCAGCAAGG - Intronic
935807751 2:106765785-106765807 ATCTCATGGTAGAAGGTGGAAGG + Intergenic
935851438 2:107224379-107224401 CTCACATGGTAGAAGGGGTGAGG + Intergenic
936262976 2:110978252-110978274 CTCACATGGCAGAAGGCAGAAGG + Intronic
936596900 2:113856778-113856800 CTCACATGGCAGAAGGCAGAAGG - Intergenic
936751497 2:115647736-115647758 CTCACATGGTAGGAAGAGAAAGG + Intronic
937055410 2:118930907-118930929 CTCACATGGCAGATGGTGGAAGG + Intergenic
937433880 2:121864147-121864169 CTCACATGGTGGAAGGGGAAAGG - Intergenic
938556856 2:132432277-132432299 CTCACATGGTGGAAGGGGCAAGG + Intronic
938945876 2:136211639-136211661 TTCACATGGTAGAAGGAGCAAGG + Intergenic
938961487 2:136345511-136345533 CTCACATGGCAGAAGGAGCAAGG + Intergenic
939119570 2:138100388-138100410 CTCACATGGTAGAAGGAGCCTGG + Intergenic
939202024 2:139048244-139048266 CACACATGATAGAGGGAGGGAGG + Intergenic
939826099 2:147017229-147017251 CCCACATGGTGGAAGGGGCAAGG + Intergenic
940285560 2:152029780-152029802 CTCAAATGGTAGAAGGGGCAAGG - Intronic
940372781 2:152921408-152921430 CTCACATGGTAGAAGGGGCAAGG + Intergenic
940418435 2:153449792-153449814 CTCACATGACAGAAGGTGGAAGG + Intergenic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
940682666 2:156806085-156806107 CAATCATGGTAGAAGGAGAAGGG + Intergenic
941162556 2:162052388-162052410 CCCACATGGTGAAAGGTAGAGGG - Intronic
941348839 2:164406127-164406149 CTCACATGGCAGAAGGAGCAAGG - Intergenic
941688851 2:168477132-168477154 CTCACATGGTAGAGTGAGGGAGG + Intronic
941856279 2:170234367-170234389 CTCACATGGCAGAAGGCAGAAGG + Intronic
942718239 2:178919075-178919097 CTCACATGGTGGAAGGGGCAAGG - Intronic
942850748 2:180482495-180482517 CTCACATGATTGAAGGTGGAGGG + Intergenic
942855652 2:180543958-180543980 CTCACATGGTAGAAGGAGTGAGG - Intergenic
943195623 2:184744478-184744500 CTCACATGGTGGAAGGGGCATGG - Intronic
943204471 2:184875465-184875487 CACTCATGGTAGAAAGAGAAGGG - Intronic
943592711 2:189818397-189818419 CTCACATGGCAGAAGAAGGAAGG - Intronic
943650672 2:190454554-190454576 CTCATATGGTAGAGGGAGGGCGG - Intronic
943771434 2:191721848-191721870 CCCCCAGGGAAGAGGGAGGAAGG + Intergenic
943819379 2:192300631-192300653 TTCACATGGTTGAAGGAGCAAGG - Intergenic
944016931 2:195051776-195051798 TCCTCATGGTAGAAGGTGAAGGG - Intergenic
944167083 2:196734507-196734529 CTCACATGGTGGAAGGCAGAAGG - Intronic
944223576 2:197326641-197326663 CTCACATGGCAGAAGGCTGAAGG - Intergenic
944467609 2:200018793-200018815 CTCACATGGCAGAAGGGGTAAGG + Intergenic
944577778 2:201106241-201106263 CTCATATGGTAGAAGGGGCAAGG - Intergenic
944728831 2:202498310-202498332 ACCACATGGAGGACGGAGGAAGG - Intronic
946284431 2:218692490-218692512 CCGACATGGCAGCAGGAGTAGGG - Intronic
946512190 2:220370178-220370200 ATCACATGGTACAAGGTGGAAGG + Intergenic
946866736 2:224047650-224047672 CTCACATGGCAGGAGGAGTAAGG - Intergenic
946972352 2:225108565-225108587 CTCACATGGTGGAAGGGGCAAGG + Intergenic
947047436 2:226004505-226004527 CTCATATGGTAGAAGGTGGAAGG + Intergenic
947069821 2:226276189-226276211 CTCACATGGCAGAAGGAGCACGG + Intergenic
947108840 2:226696878-226696900 ACATCATGGTAGAAGGAGGTGGG + Intergenic
947436432 2:230076766-230076788 CTCACATGATAGAAGGGGCAGGG + Intergenic
947510772 2:230752455-230752477 CTCACATGGTGAAAGGTGGAAGG + Intronic
947665644 2:231903887-231903909 CTCACATGGCAGAAGCTGGAAGG + Intergenic
947845136 2:233237708-233237730 CTCACATGGTAGGAGGAGCAAGG + Intronic
947994965 2:234519509-234519531 CTCACATGGTGGAAGGGGCAAGG + Intergenic
948222661 2:236285332-236285354 CTCACATAGCAGAAGGTGGAAGG - Intergenic
948582955 2:239000333-239000355 CTCACATGGTGGAAGGGGCAAGG + Intergenic
948765997 2:240219354-240219376 CTCACATGGCAGAAGGGGTAAGG + Intergenic
948868855 2:240788365-240788387 CCCACAAGGCAGGAGTAGGATGG - Intronic
1169135117 20:3192532-3192554 CTCAGATGGTATAAAGAGGATGG - Intronic
1169331401 20:4719309-4719331 CCCACATGGCAGAAGGGACAAGG + Intergenic
1169399034 20:5264193-5264215 CCCTCATGGTGGAAGGTGAAGGG + Intergenic
1169624745 20:7552669-7552691 CCCACATGGCAGAAGATGGAAGG + Intergenic
1169635794 20:7690038-7690060 CTCACATGGTAGAAGGAAAAAGG - Intergenic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170020091 20:11827791-11827813 TTCACATGGTAGAAGGGGCAAGG - Intergenic
1170195530 20:13685280-13685302 CTCACATGGCAGAAGGCTGAAGG + Intergenic
1170420034 20:16183701-16183723 CTCACATGGTGAAAGGAGCAAGG - Intergenic
1170610361 20:17907747-17907769 CTCACATGGTAGAAAGTGGAAGG + Intergenic
1170796938 20:19556052-19556074 CTCACATGGTGGAAGGGGCAAGG + Intronic
1170819775 20:19747037-19747059 ATCACATGGCAGAAGGTGGAAGG + Intergenic
1170896137 20:20416221-20416243 CCCACATGGTAGAGGCAGGGAGG - Intronic
1171023304 20:21606893-21606915 CCCAAATGCCAGAATGAGGAGGG + Intergenic
1171238177 20:23544898-23544920 CTCACGTGGTAGAAGGTGGAAGG - Intergenic
1171519348 20:25764294-25764316 CCCACAGGGAATAAGGAGCAGGG - Intronic
1171524869 20:25800943-25800965 CTCACATGGCAGAAGGTGGAAGG + Intronic
1171534057 20:25870610-25870632 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171551958 20:26054940-26054962 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1171571231 20:26253484-26253506 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171726257 20:28623891-28623913 CTCACATGGTGGAAGGTGGGAGG + Intergenic
1171855383 20:30338166-30338188 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1172005806 20:31818678-31818700 CCCACATGGAAGAAGGGGGCTGG - Intergenic
1172822374 20:37748752-37748774 CTCACATGGTGGAAGGAGTGAGG + Intronic
1172835650 20:37871441-37871463 CTCACATTGCAGAAGGGGGAAGG + Intronic
1172962145 20:38806676-38806698 TCTACATGGGGGAAGGAGGAGGG - Intronic
1173574582 20:44103936-44103958 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1173674280 20:44820412-44820434 CCCACATGTCAGAAGGGGGATGG + Intergenic
1174014829 20:47479370-47479392 CCAAGATGGTAGAAAGAGAAAGG + Intergenic
1174517766 20:51106296-51106318 CTCACATGGCAGAAGGGGAAAGG - Intergenic
1174681526 20:52413593-52413615 CACTCATGGTGGAAAGAGGAAGG + Intergenic
1175916676 20:62429204-62429226 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1176653490 21:9570575-9570597 CCCACAGGGAATAAGGAGCAGGG - Intergenic
1176691873 21:9921987-9922009 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1177080693 21:16635203-16635225 ATCACATGGCAGAAGGAGCAAGG - Intergenic
1177338441 21:19763788-19763810 CCCACATGGTGGAAGGGGCAAGG - Intergenic
1177693607 21:24542077-24542099 TTCACATGGCAGAAGGTGGAAGG + Intergenic
1177802358 21:25840379-25840401 CTCACATGGTAGAAGGGCAAGGG + Intergenic
1177843438 21:26260061-26260083 CTCACATGGTAGAAGAATGAAGG - Intergenic
1178159419 21:29894426-29894448 CCAGCATGGGAGAAGGATGAAGG + Intronic
1178642917 21:34361051-34361073 CTCACATGGTGGAAAGGGGAAGG + Intergenic
1179097961 21:38332493-38332515 CCCCCATGGCAGAAGGTGGAAGG + Intergenic
1179284862 21:39968564-39968586 CTCACATGGTGGAAGGGGTAAGG + Intergenic
1180198969 21:46213507-46213529 CCCAGAAGGTAGAGTGAGGAAGG - Intronic
1180573408 22:16750504-16750526 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1180840494 22:18956820-18956842 CCCACATGGCAGGAGGGGGCTGG - Intergenic
1181018473 22:20085129-20085151 CCCACAGGGTAGCACGTGGACGG - Intronic
1181060994 22:20281954-20281976 CCCACATGGCAGCAGGGGGCTGG + Intronic
1181975710 22:26727896-26727918 TTCACATGGCAGAAGGTGGAAGG + Intergenic
1182483486 22:30625351-30625373 CTCACATGGTGGAAGGAACATGG + Intronic
1182782500 22:32879511-32879533 CTCACATAGTCGAAGGGGGAAGG + Intronic
1182817638 22:33180007-33180029 CTCACATGGCAGAAGGCAGAAGG - Intronic
1182920540 22:34075215-34075237 CTCACATGGCAGAAGGGGGAAGG + Intergenic
1182955139 22:34417429-34417451 CCCACATGGTGGAAGGAGTGAGG + Intergenic
1182956165 22:34428698-34428720 CCCACATGTTGCAAGGAGGATGG - Intergenic
1183012394 22:34957590-34957612 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1183799221 22:40147565-40147587 CCCACGTGGCAAAAGGTGGAAGG + Intronic
1183870858 22:40741109-40741131 CTCACATGCTGGAAGGAGCAAGG - Intergenic
1184081670 22:42225745-42225767 CCCACAAGTCAGAAGCAGGAGGG + Intronic
1184290924 22:43497789-43497811 CCCACCTGGGGGAGGGAGGATGG + Intronic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1184589474 22:45471974-45471996 CACTCATGGTGGAAGGAGAAGGG - Intergenic
1185019735 22:48367147-48367169 CTCACATGGAGGAAGGAGGAGGG + Intergenic
1185070964 22:48655492-48655514 CTCACGTGGTGGAAGGTGGAAGG + Intronic
949152802 3:790883-790905 CTCTCATGGTAGAAGAAGAAAGG - Intergenic
949210896 3:1499776-1499798 ATCCCATGGCAGAAGGAGGAAGG + Intergenic
949256551 3:2054044-2054066 CTCACATGGTGGAAAGGGGAAGG - Intergenic
949316007 3:2756360-2756382 CTCACATGGCAGAAGGAGCAAGG - Intronic
949830812 3:8212266-8212288 TGCACATGGTAGAAGGCGGCAGG + Intergenic
949950998 3:9228721-9228743 TCAACAAGGTAGAAGAAGGAGGG + Intronic
950285461 3:11741306-11741328 CCCACACAGCAGAAGGTGGAAGG + Intergenic
950581290 3:13863994-13864016 CCCAGATTGTAGACAGAGGAGGG + Intronic
950688875 3:14639803-14639825 GTCACATGGTAGAAGGGGTAAGG + Intergenic
950896631 3:16457943-16457965 CTCACATGGTGGAAGGCAGAAGG - Intronic
951237406 3:20251732-20251754 CCACCATGGTAGAAGGTGAAAGG + Intergenic
951466871 3:23010481-23010503 CCTACATGGCTGAAGGAGCAAGG - Intergenic
951764760 3:26185349-26185371 CCCTCAGGGCAGAAGGAAGAAGG - Intergenic
951809576 3:26684603-26684625 ACCACATGGCAGAAGGCAGAAGG + Intronic
952113294 3:30149382-30149404 CTCACATGGTGGAAGGCAGAAGG - Intergenic
952124791 3:30287791-30287813 CACACATGGTGGAAGGTGGAAGG - Intergenic
952808903 3:37384040-37384062 CTCACATGGTGGAAGGCAGAAGG - Intergenic
953536332 3:43779656-43779678 CACTCATGGCAGAAGGAGAAAGG - Intergenic
954169415 3:48788694-48788716 CTCACATGGTGGAAGGAGGGAGG - Intronic
954240861 3:49292413-49292435 CACACATGGGAGAAGGGGGTTGG - Intronic
954394503 3:50286406-50286428 GCCACCTGGTAGAAGGAAGGGGG + Intronic
954773126 3:52991768-52991790 CTCATGTGGTAGAAGGTGGAAGG - Intronic
955241648 3:57183241-57183263 CTCACATGGCAGAAGGGGAAAGG + Intergenic
955515653 3:59724033-59724055 CTCACATGGTGGAAGGGGCAAGG + Intergenic
955525941 3:59819912-59819934 CTCACATGGTGGAAGGGAGAAGG - Intronic
955566225 3:60249715-60249737 CACACACGGGAGAAGGGGGAAGG + Intronic
955805351 3:62728250-62728272 CCCAGATGGTAGAAAGAACATGG - Intronic
955892376 3:63663700-63663722 CACTCATGGTAGAAGGTGAAGGG - Intronic
956704922 3:71991485-71991507 CACTCATGGTGGAAGGAGAAGGG + Intergenic
956758358 3:72412960-72412982 CTCACATGGCAGAAGGTGGAAGG - Intronic
956919187 3:73908267-73908289 CTCACATGGCAGAAGGCAGAAGG - Intergenic
956957343 3:74356124-74356146 CTCACATGGTAGAAGGGGCAAGG - Intronic
957258314 3:77867405-77867427 CTCACATGGTGGAAGCAGAAGGG + Intergenic
957279235 3:78128355-78128377 TTCACATGGTGGAAGGAGGTTGG + Intergenic
957535965 3:81503952-81503974 CACTCATGGCAGAAGGAGAAGGG + Intronic
957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
958011851 3:87889150-87889172 CACTCATGGTAGAAGGTGAAAGG - Intergenic
958189398 3:90165593-90165615 CTCACATGGTAGAAGGCAGAGGG + Intergenic
958411706 3:93825202-93825224 CTCACATGGTGGAAGGCAGAGGG + Intergenic
958732740 3:97975954-97975976 CTCACGTGGTAGAAGTGGGAAGG + Intergenic
959014742 3:101121127-101121149 CTCACATGGCAGAGAGAGGAAGG + Intergenic
959210851 3:103378346-103378368 CTCACATGGTGTAAGGAGCAAGG + Intergenic
959272400 3:104229851-104229873 CTCACATGGAAGATGGTGGAAGG - Intergenic
959508973 3:107188659-107188681 CTCACATGGTAGAAGGGGAGAGG + Intergenic
959517530 3:107286124-107286146 CTTACATGGTAGAAGGAGAGAGG - Intergenic
959518218 3:107294802-107294824 CTCACAAACTAGAAGGAGGATGG - Intergenic
959891680 3:111563057-111563079 CTCACATGGTGGAAGGCAGAAGG + Intronic
960260110 3:115557665-115557687 CTCACATAGTGGAAGGAGCAAGG + Intergenic
960392348 3:117092934-117092956 CTCACATGGTGGAAGGCAGAAGG + Intronic
960697746 3:120412415-120412437 CTCACATGGCAGAAGGCAGAAGG - Intronic
961222506 3:125212078-125212100 ACCCTTTGGTAGAAGGAGGAAGG + Intronic
961497709 3:127306444-127306466 CTCACACGGTAGAGAGAGGAGGG - Intergenic
961831205 3:129623810-129623832 CCCACCGGGAGGAAGGAGGAAGG + Intergenic
962128491 3:132647914-132647936 CTCACATGGTGGAAGGGGCAAGG + Intronic
962160852 3:132998802-132998824 CTCACGTGGTGGAAGGTGGAAGG - Intergenic
962451985 3:135527469-135527491 CTTACATGGTGGAAGGAGCAAGG - Intergenic
962957601 3:140280434-140280456 TCCAGAAGGTAGAAGGAGAAAGG + Intronic
963010787 3:140768378-140768400 CTCACATGGTGGAAGGAGCAAGG - Intergenic
963645463 3:147908350-147908372 CTCACATGGTGGAAGGGGCAAGG - Intergenic
963713550 3:148776173-148776195 CTTACATGGTAGAAGGCAGAAGG - Intergenic
964165134 3:153695079-153695101 CTCACATGGCAGAAGGGAGAAGG - Intergenic
964843916 3:161025624-161025646 CTCACATGGTAGAAGATAGAAGG - Intronic
964964315 3:162472131-162472153 ATCACATGGTGGAAGGTGGAAGG + Intergenic
965211436 3:165794547-165794569 CTCACATAGTAGAAGGGAGAAGG + Intronic
965707382 3:171522693-171522715 CCAACATGGGAGAAAGATGAAGG - Intergenic
966153240 3:176888879-176888901 TTCACATGGTAGAAGGGGGTAGG - Intergenic
966566887 3:181392950-181392972 CACTCATGGTAGAAGGTGAAGGG + Intergenic
967646879 3:191935470-191935492 CACTCATGGCAGAAGGAGAAGGG - Intergenic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
968095816 3:195929754-195929776 CTCACATGGCAGAGGGAGGGAGG - Intergenic
968911051 4:3477182-3477204 CCAACATGGGAGAAAGTGGAGGG - Intronic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969911439 4:10450484-10450506 GCCACATGGAAGAATGAAGATGG + Intronic
969965234 4:10987180-10987202 CTCATATGGTAGAAGGGGCAAGG - Intergenic
970113562 4:12667775-12667797 CTCACATGGTAGAAGAAACAAGG + Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970207313 4:13667959-13667981 TCCACATGGTGGAAGGAGTGAGG + Intergenic
970577247 4:17439372-17439394 TACTCATGGTAGAAGGAGAAGGG + Intergenic
970809227 4:20072031-20072053 CACTCATGGTGGAAGGAGAAGGG + Intergenic
970857158 4:20662153-20662175 GCCACAGGGTAGAAGGAGCCCGG - Intergenic
970964562 4:21913397-21913419 CTCACATGGCAGAAGGCAGAAGG - Intronic
971272749 4:25166045-25166067 CTCACATGGCAGAAGGTGGAAGG - Intronic
971361960 4:25946405-25946427 CTCACATGGTGGAAGGCAGAAGG + Intergenic
971504047 4:27347419-27347441 CTCATATGGCAGAAGGAGCAAGG + Intergenic
971520579 4:27545871-27545893 CTCACATGGCAGAAGGCAGAAGG + Intergenic
971582616 4:28361954-28361976 CGCACATGGCAGAAGAAGCAAGG - Intergenic
971614574 4:28771390-28771412 TTCACATGGTGGAAGGAGCAAGG + Intergenic
971945671 4:33273530-33273552 CTCACATGGCAGAAGGTGGAAGG - Intergenic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972226146 4:37015127-37015149 CTCACATGGTGGAAGGAACAAGG - Intergenic
972236233 4:37137164-37137186 CTCGCATGGTAGAAGGCAGAAGG - Intergenic
972803755 4:42506303-42506325 CTCACATGGTAGAAGGGGCAAGG - Intronic
972908870 4:43788284-43788306 CCCAGTTGTAAGAAGGAGGAGGG + Intergenic
972990453 4:44817206-44817228 CTCACATGGTGGAAGGGGCAAGG + Intergenic
973659571 4:53089002-53089024 CTCACATGATAGAAGAAGTAGGG - Intronic
973794802 4:54413939-54413961 CTCACATGGTGGAAGAGGGAAGG + Intergenic
973794999 4:54416160-54416182 CTCACATGGTGGAAGAGGGAAGG + Intergenic
974356677 4:60821557-60821579 CCAGCATGGTAGAAAGATGAAGG - Intergenic
974469080 4:62295919-62295941 CTCACATGGTAGAAGGTGAAGGG + Intergenic
974572821 4:63676190-63676212 CTCACATGGTTGAAGAAGTAGGG - Intergenic
974610597 4:64210394-64210416 CTCACATGGTGGAAGGTAGAAGG - Intergenic
975019677 4:69471048-69471070 CTCACATGGTGGAAAGTGGAAGG + Intergenic
975028724 4:69585763-69585785 CTCACATGGTAGAAGTGGAATGG + Intergenic
975099902 4:70500980-70501002 CCAGCATGGAAGAAAGAGGAAGG + Intergenic
975713927 4:77187689-77187711 CTCACATGGTAAAAGGAGCAGGG - Intronic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
976334697 4:83871822-83871844 CTCACATGGTAGAAGGGGCAAGG + Intergenic
976425732 4:84901077-84901099 CTCACATGGCAGAAGGCGAAAGG + Intronic
976437342 4:85033292-85033314 ATCACATGGTAGAAGGCAGAAGG + Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
977537781 4:98276154-98276176 CTCACACGGTAGAAGGAGTGAGG + Intronic
977540068 4:98306364-98306386 CTCACATGACAGAAGGTGGAAGG + Intronic
977644028 4:99391033-99391055 CTCACATGGAAAAAGGTGGAAGG + Intergenic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
977748600 4:100581002-100581024 CTCACATGGCAGAAGGAGCAAGG - Intronic
977779321 4:100961882-100961904 CTCACATGGTGGAAGAAGCAAGG - Intergenic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978099138 4:104815269-104815291 CTCACATGACAGAAGGTGGAAGG - Intergenic
978414128 4:108457709-108457731 CTCAAATGGTAGAAGGCAGAGGG - Intergenic
978494964 4:109348800-109348822 CTCACATGGTGGAAGGGGCAAGG - Intergenic
978696570 4:111587191-111587213 CTCACATGGTGGAAGGGTGAAGG + Intergenic
978768919 4:112433319-112433341 CTCACATAGTGGAAGGGGGAAGG + Intronic
979021221 4:115501043-115501065 CTCACATGGTGGAAGGAGGAAGG - Intergenic
979141899 4:117186209-117186231 TTCACATGGTGGAAGGTGGAAGG - Intergenic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979366503 4:119830799-119830821 TTCACATGGTAGAAGGGGTAAGG - Intergenic
979418214 4:120469836-120469858 CTCACATGGCAGAAGGCAGAAGG - Intergenic
979471359 4:121101339-121101361 CTCACATGGAAGAAGGTGGAAGG - Intergenic
979727088 4:123975045-123975067 CTCACATGGTGGAAGGAGCCAGG - Intergenic
980212942 4:129813737-129813759 CCCTCATGGTGGAAGGTGAAGGG + Intergenic
980310973 4:131128414-131128436 CTCACATGGCCGAAGGAGGAAGG - Intergenic
980364459 4:131782190-131782212 CTCACATGGTGGAAGAGGGAGGG - Intergenic
980452417 4:132991808-132991830 CTCACATGGTGGAAGGTGGAAGG - Intergenic
980537902 4:134152869-134152891 CACTCATGGTAGAAGGAAAAGGG + Intergenic
980727063 4:136776535-136776557 CTCACATGGTGGAAGGTGGAAGG - Intergenic
980972149 4:139576794-139576816 CTCACATGGCAGAAGGGGTATGG + Intronic
980976574 4:139616792-139616814 CTCACATGGTGGAAGGTGGAAGG + Intergenic
981038743 4:140199921-140199943 CTCACATGGTGGAAGGGGTAAGG + Intergenic
981052371 4:140321982-140322004 CTCACATGGCAGGAGGTGGAAGG - Intronic
981244010 4:142513370-142513392 CTCACATGGTAGGAGGGGCAAGG + Intronic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981367765 4:143923164-143923186 CTCACATGGCAGAAGAAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981651020 4:147059249-147059271 CTCACATAGTGGAAAGAGGAAGG - Intergenic
981698358 4:147581523-147581545 CTCACATGGCAGAAGGTGGAAGG - Intergenic
982108501 4:152032044-152032066 CCAGCATGGGAGAAAGAGGAAGG + Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
982412263 4:155091934-155091956 CTCAAATGGTGGAAGGAAGAAGG - Intergenic
982709977 4:158748235-158748257 CTCACATGGTGGAAGGCAGAGGG - Intergenic
982743198 4:159079330-159079352 CTCACATGGTGGAAGGGGCAAGG - Intergenic
982882309 4:160734797-160734819 CTCACATGGTGGAAAGAGCAAGG - Intergenic
982951191 4:161698140-161698162 CTCACATGGCAGAAGGCAGAAGG - Intronic
982980507 4:162128457-162128479 CTCACATGGTGGAAGGGGCAAGG - Intronic
983283944 4:165715748-165715770 CTCACAGGGTGGAAGGAGGAAGG - Intergenic
983477061 4:168226418-168226440 CTCACATGGTGGAAGGGGCAAGG - Intronic
983500635 4:168495390-168495412 CTCACATGGCAGAAGGTGGAAGG - Intronic
983842625 4:172476260-172476282 CTAACATGGCAGAAGGAGCAAGG + Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
983972741 4:173894487-173894509 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984042862 4:174758070-174758092 CACTCATGGCAGAAGTAGGAAGG - Intronic
984045727 4:174796180-174796202 CTCACATGGTGGAAGGGGCAAGG - Intronic
984147724 4:176084274-176084296 CACTCATGGTAGAAGGTGAAGGG + Intronic
984306373 4:177997153-177997175 CCAACATGGGAGAAAGATGAAGG + Intergenic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984468888 4:180140071-180140093 TTCACATGATAGAAGGAGCAAGG + Intergenic
984633227 4:182082250-182082272 CTCACATGGCAGAAAGAGCAAGG + Intergenic
984808475 4:183772930-183772952 CTCACATGGTGGAAGGAGTGAGG + Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
984900647 4:184583223-184583245 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984983194 4:185302621-185302643 CTCACATGGCAGAAGGTGCAAGG - Intronic
985010622 4:185578899-185578921 CTCACATGGTAGAAAGAGAAGGG - Intergenic
985254738 4:188058480-188058502 CTCACATGGCAGAAGGCAGAAGG + Intergenic
985434270 4:189913810-189913832 CTCACATGGTGGAAGGTGGGAGG - Intergenic
986099229 5:4591001-4591023 CTCATCTGGTAGAAGGAGGTAGG - Intergenic
986290144 5:6393188-6393210 CACTCATGGTAGAAGGTGAAGGG - Intergenic
986628748 5:9748548-9748570 CACTCATGGTGGAAGGTGGAAGG + Intergenic
986666934 5:10112692-10112714 TGCACATGGTAGAAGGAGTGGGG + Intergenic
986805813 5:11307971-11307993 CTCACATGGTGGAAAGAGAATGG - Intronic
987477404 5:18408557-18408579 CTCACACGGTGGAAGGAGCAAGG - Intergenic
987571062 5:19659709-19659731 CTCACATGGCAGAAGGCAGAAGG - Intronic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
987824318 5:23008700-23008722 CTCACATGGGAGAAGGCAGAAGG - Intergenic
988821227 5:34888122-34888144 CTCACATGGTGGAAGGGGCAAGG - Intronic
988858139 5:35249065-35249087 CTCACATGGCAGAAGGAGCAAGG + Intergenic
989340557 5:40369438-40369460 CTCACATGAAAGAAGGTGGAAGG + Intergenic
989381335 5:40812368-40812390 CTCACATGGTAGAAGAGGTAAGG + Intergenic
990700164 5:58466498-58466520 CTCACATGGTGGAAGGGGCAAGG - Intergenic
990755693 5:59066824-59066846 CTCACATGGTGGAAGGGGCAAGG - Intronic
991194478 5:63916668-63916690 CTCACATGGCAGAAGGTGAAAGG - Intergenic
991220403 5:64208274-64208296 CCCACACGGAGGAAGGAGGAAGG - Intronic
991221526 5:64224900-64224922 CTCACATGGCAGAAGGTGGAAGG - Intronic
991357517 5:65784534-65784556 CTCACATGGCAGAAGGGGGAAGG + Intronic
991452554 5:66768368-66768390 CCCACATTGTCACAGGAGGAAGG + Intronic
991514194 5:67415760-67415782 CTCACGTGGTAGAAGAAGCAAGG + Intergenic
991580438 5:68149096-68149118 CTCACATGGTGGAAAAAGGAAGG - Intergenic
991671348 5:69051271-69051293 CTCACATGGTGGAAGGGGCAAGG - Intergenic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
992388039 5:76304708-76304730 CTCACATGGTGGAAGGCAGAAGG + Intronic
992476278 5:77104502-77104524 CTCACATGGCAGAAGGCAGAAGG - Intergenic
992485924 5:77195200-77195222 CTCACATGGCAGAAGGCAGAAGG + Intergenic
992601460 5:78404811-78404833 TCCACTTGTTAGAAGAAGGAGGG + Intronic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
992832182 5:80604442-80604464 CCGACATGGCAGAAGGCTGAAGG - Intergenic
992898344 5:81267559-81267581 CCCAAATGGTAGAGGGTGAAGGG + Intergenic
993023364 5:82618485-82618507 CTCACATGGCAGAAGGTTGAAGG + Intergenic
993453862 5:88105081-88105103 TTCACATGGTAGAAGGAGAAAGG - Intergenic
993488423 5:88515470-88515492 CTCACATGGTATAAGGAACAAGG + Intergenic
993645169 5:90452989-90453011 ACCTCATGGTGGAAGGTGGAAGG + Intergenic
993775852 5:91994579-91994601 CTTACATGGTGGCAGGAGGAAGG + Intergenic
993823885 5:92657030-92657052 TCAACATTGTAGAAGGAAGAGGG + Intergenic
994117519 5:96077725-96077747 CACTCATGGTAGAAGGAGAAGGG - Intergenic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
994949919 5:106448528-106448550 CTCACATGGTGGAAGGCAGAAGG - Intergenic
994958949 5:106572928-106572950 ACCACATGGCAGAAGGCAGAAGG - Intergenic
995514091 5:112937113-112937135 CCCACATGGCAGAAGGTGGGAGG - Intergenic
995562555 5:113398675-113398697 ACTACATGGGAGAGGGAGGAAGG + Intronic
995921723 5:117322307-117322329 CCCACATGGTGGAAGGAGATAGG - Intergenic
995926850 5:117385364-117385386 CTCACATGATGTAAGGAGGAAGG - Intergenic
996182191 5:120432577-120432599 CTCACATGGCAGAAGGTGGAAGG - Intergenic
996428282 5:123339422-123339444 CTCACATGGTAGAAGAATGAAGG + Intergenic
996484156 5:124011837-124011859 CCAACATTGTAGAGGGAGGATGG - Intergenic
996643693 5:125790215-125790237 CTCACATGGCTGAAGGAGAAGGG - Intergenic
996647470 5:125833936-125833958 CTCACATAATAGAAGGTGGAAGG + Intergenic
997107835 5:131041533-131041555 CTCACATGGTAGAAAGGGCAAGG - Intergenic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997715613 5:136040543-136040565 CCCAGATGGTGGCAGGGGGAAGG - Intronic
997855959 5:137373046-137373068 ATCACATGGTGGAAGGTGGAAGG - Intronic
997909389 5:137854963-137854985 CTCACATGGTAGAAGGGGCAAGG - Intergenic
998200143 5:140113007-140113029 CCCAAATCTCAGAAGGAGGAGGG + Intronic
999122215 5:149218286-149218308 TCCACATGGTGGAAGGGGCAAGG + Intronic
999895446 5:156027941-156027963 CTCATATGGCAGAAGGTGGAAGG + Intronic
999897853 5:156053892-156053914 CCCACATGGTGGAAGGGGCAAGG + Intronic
1000160980 5:158597549-158597571 CACACATGGCAGAAAGTGGAAGG + Intergenic
1000610532 5:163368662-163368684 CACTCATGGTAGAAGGTGAAAGG - Intergenic
1000645611 5:163757078-163757100 CCCACCTGTGGGAAGGAGGAAGG + Intergenic
1001224441 5:169931721-169931743 CTCACATGGGAGAAGGTGGCTGG + Intronic
1001673590 5:173494086-173494108 CCCAGCCGGCAGAAGGAGGAAGG + Intergenic
1001814268 5:174654921-174654943 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1001947233 5:175789838-175789860 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1002811663 6:637030-637052 GCCACATCATGGAAGGAGGAAGG + Intronic
1003080294 6:3016061-3016083 CCCACGTGGCAGGATGAGGAGGG + Intronic
1003183465 6:3811133-3811155 CTCACATGGGAGAAGGTGAAAGG - Intergenic
1003846895 6:10183098-10183120 CTCACATGGTGGAAGGAGATAGG - Intronic
1003877041 6:10447080-10447102 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1004249893 6:14015205-14015227 CTCACATAGTGGAAGGTGGAAGG + Intergenic
1004522674 6:16377083-16377105 CTCACATGGTGGAAGGAGCAAGG - Intronic
1004791100 6:19027417-19027439 TTCACATGGCAGAAGGAGCAGGG - Intergenic
1004792983 6:19049792-19049814 CTCACATGATATAAGGTGGAAGG - Intergenic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1005904882 6:30253590-30253612 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1006231638 6:32592973-32592995 CTCACATGGTAGAATGTGGAAGG + Intergenic
1006241509 6:32683915-32683937 ATCACATGGTGGAAGGTGGAGGG - Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1006761252 6:36463650-36463672 CTCACATGATGGAAGGAGAAGGG - Intronic
1006869025 6:37233480-37233502 CTCACATGGGAGAAGGTGGAAGG + Intronic
1006932348 6:37695933-37695955 CCCACAGGATGGAAGGGGGAAGG + Intronic
1007116445 6:39346405-39346427 CTCACATGGTGGAAGGGGCAAGG - Intronic
1007275391 6:40669565-40669587 CTCACGTGGCAGAAGGTGGAAGG - Intergenic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1007702813 6:43774354-43774376 CACCCATGGCAGAAGGAGGAGGG + Exonic
1007928354 6:45668314-45668336 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1008158507 6:48047728-48047750 CTCACATGATAGAAGGGGCAAGG - Intronic
1008536462 6:52509681-52509703 CCCACCTGACAGAAAGAGGAAGG + Intronic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1008668236 6:53738759-53738781 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1009336902 6:62502325-62502347 CTCACATGGTAGAAGGGGCGAGG - Intergenic
1009344872 6:62600948-62600970 CCCTCATGGCAGAAGGTGAAGGG - Intergenic
1009409653 6:63351135-63351157 CTCACATGGTAGAAATGGGAAGG - Intergenic
1009763128 6:68034811-68034833 CTCACATGGTGGAAGGGAGAAGG - Intergenic
1010624442 6:78119837-78119859 CGATCATGGTAGAAGGTGGAAGG - Intergenic
1010866902 6:80986916-80986938 ACCACATGGTAGAAATAGGCAGG + Intergenic
1010986965 6:82435696-82435718 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1011352803 6:86441162-86441184 CTCACATAGTAGAAGGGGCAGGG - Intergenic
1011574916 6:88786940-88786962 CCCACATGGCAGAAGGGGCAAGG - Intronic
1011756101 6:90499644-90499666 CTCACATGGTACAAGGGTGAGGG + Intergenic
1011859610 6:91738271-91738293 CTCACATGGTGGAAGGGGGCTGG + Intergenic
1012037420 6:94160366-94160388 CTAACATAGTAGAAGGTGGAAGG - Intergenic
1012443227 6:99281664-99281686 CTCACATGGTAAAAGGGGGAAGG - Intronic
1012599618 6:101079063-101079085 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1012874268 6:104707693-104707715 CTCAAATGGTAGAAGGTAGAAGG + Intergenic
1013120549 6:107136984-107137006 CACTCATGGTGGAAAGAGGAAGG + Intergenic
1013688307 6:112610754-112610776 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1013786712 6:113789448-113789470 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1013832588 6:114292320-114292342 CTCACGTGGCAGAAGGTGGAAGG + Intronic
1013850107 6:114504051-114504073 CTCACATGGCAGAAGTTGGAAGG + Intergenic
1013957862 6:115861402-115861424 CTCATATGGTGGAAGGAGAAAGG + Intergenic
1014127099 6:117789325-117789347 CTCACATGGTGGAAGGGTGAAGG + Intergenic
1014503620 6:122225800-122225822 CTCACATGGTGGAAGGCAGAAGG + Intergenic
1014808942 6:125863799-125863821 CTCACATGGTAGAAGGGTGAGGG + Intronic
1015187093 6:130430219-130430241 CTCACATGGTAGAAGGGGGAAGG + Intronic
1015421413 6:133013818-133013840 CTTACGTGGTAGAAGGTGGAAGG - Intergenic
1015657212 6:135532521-135532543 CCATGATGGAAGAAGGAGGATGG - Intergenic
1015977028 6:138800969-138800991 CTCACATGGCAGAAGGTGGAAGG + Intronic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1016409541 6:143767665-143767687 ATCACATGGTGGAAGGTGGAAGG + Intronic
1016526741 6:145010195-145010217 CCTACATGGTGGAAGGTGGAAGG - Intergenic
1016563517 6:145424750-145424772 CTCACGTGGTGGAAGGAGCAAGG - Intergenic
1016753454 6:147657732-147657754 CTCACATGGTAGAAGGGGCATGG + Intronic
1016904640 6:149136765-149136787 CTCACATGGCAGAAGGGGAAGGG + Intergenic
1016983398 6:149874934-149874956 CCCACATGGTGGAAGGCAGAAGG + Intergenic
1017054231 6:150423698-150423720 CCCGCATGGTAGAAGGGGCAGGG + Intergenic
1017187488 6:151616810-151616832 CTCACATGGTGGAAGGAGCAAGG + Intronic
1017203604 6:151781315-151781337 TCTACATGGTGGAAGGCGGAAGG + Intronic
1017282706 6:152640729-152640751 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1017402053 6:154075784-154075806 CCCATCTGTTAGAGGGAGGAAGG + Intronic
1017548982 6:155483636-155483658 TTCACCTGGCAGAAGGAGGAAGG - Intergenic
1017852349 6:158315797-158315819 CTCACATGGTGGAAGGGGCAAGG + Intronic
1018127018 6:160691637-160691659 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1018149540 6:160925443-160925465 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1018154071 6:160969253-160969275 CTCACCTGGTAGAAGGGGTAAGG - Intergenic
1018158716 6:161015622-161015644 CACTCAAGGTAGAAGGAGAAGGG + Intronic
1018442238 6:163823874-163823896 CCCACGTGGCAGAGAGAGGAAGG - Intergenic
1019897328 7:3992440-3992462 CCCACCTGGTGGATTGAGGAGGG + Intronic
1020033182 7:4947349-4947371 CTTACATGGGAGCAGGAGGAAGG + Intronic
1020364989 7:7371559-7371581 CCCAGGTGGGTGAAGGAGGAAGG + Intronic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1021468217 7:20969859-20969881 CTCACATGGAGGAAGGTGGAAGG - Intergenic
1021487965 7:21187707-21187729 CCTACATGGTAGAAGGGGCAAGG - Intergenic
1021523512 7:21560590-21560612 CCAGCATGGGAGAAGGATGAAGG + Intronic
1021927835 7:25550409-25550431 CCCAGAGGGGAGAAGGAGAAAGG - Intergenic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1022183235 7:27942254-27942276 ACCACAGGGGTGAAGGAGGAAGG - Intronic
1022323714 7:29310742-29310764 CTCACATGGTGGGAGGAGGAAGG + Intronic
1022566264 7:31405855-31405877 CCCACAGGGTAGACAGAGGGAGG - Intergenic
1022610113 7:31862583-31862605 CTCACATGGCAGAAGAGGGAAGG + Intronic
1022767615 7:33431565-33431587 CCCACATGGTAAAAGGGGCAAGG - Intronic
1023384999 7:39647728-39647750 CTCACATGGTGGAAGGAGCAAGG - Intronic
1023455051 7:40329535-40329557 CCCTCAGGCGAGAAGGAGGAGGG - Intronic
1023650653 7:42365358-42365380 CAATCATGGTAGAAGGTGGAAGG + Intergenic
1023661998 7:42479442-42479464 CCCACCTGATAGTAGGAGGTTGG + Intergenic
1023988875 7:45115990-45116012 CTCACATGGCAGAAGGAGAAAGG - Intergenic
1024259048 7:47560258-47560280 CTCACATGGTAGAGGGGTGAGGG - Intronic
1024338994 7:48238150-48238172 CTCACGTGGTAGAAGGGGTAAGG + Intronic
1024466851 7:49720461-49720483 CACTCATGGTAGAAGGTGAAGGG + Intergenic
1024566578 7:50686241-50686263 CTCACATGGTGGAATGGGGAAGG - Intronic
1024657480 7:51463931-51463953 TTCACATGGTGGAAGGAGCAAGG + Intergenic
1024964647 7:55013193-55013215 CTCACATGGCAGAAGGACCAAGG - Intergenic
1025285530 7:57657543-57657565 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1025300613 7:57817229-57817251 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1027154864 7:75759708-75759730 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1027389566 7:77691694-77691716 CTCACATGGTAGAAGGCAGCAGG - Intergenic
1027418166 7:77994413-77994435 CTCACATGATGGAAGGTGGAAGG + Intergenic
1027624994 7:80533663-80533685 CTCACTTGGCAGAAGGTGGAAGG - Intronic
1027695727 7:81407816-81407838 TTCACATGGTGGAAGGAGTAAGG - Intergenic
1027932088 7:84550522-84550544 TCCTCATGGTAGAAGGTGAAGGG - Intergenic
1028637071 7:93001140-93001162 CTGACATGGTACAAGGAGAAAGG - Intergenic
1028766766 7:94568795-94568817 CACACATGGTGGAAGGGGCAAGG - Intergenic
1029410687 7:100408282-100408304 CCCAACTGGTAGAAAGAAGAGGG - Intronic
1030225837 7:107149500-107149522 CTCACATGGTGGAAGGGGCAAGG + Intronic
1030324904 7:108208794-108208816 CCCATATGGTACAAGTAGAAGGG - Intronic
1030508423 7:110453915-110453937 CTCACATGGTGGAAAGAAGAAGG + Intergenic
1030874802 7:114800551-114800573 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1031088985 7:117330089-117330111 ACCACATGGCAGAAGGAAGGAGG - Intergenic
1031283383 7:119833892-119833914 CTCACATGGTAGAAAAAGCAAGG - Intergenic
1031310631 7:120192744-120192766 CTCACATGGTGGAAGCAGCAAGG + Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031718322 7:125135883-125135905 CTCACGTGGTAGAAGAAGAAAGG - Intergenic
1032761889 7:134951070-134951092 CTTACATGGTGGAAGGAGAAAGG + Intronic
1033024187 7:137756926-137756948 CCCACATGGTTGAGAGAAGAAGG - Intronic
1033366524 7:140676207-140676229 ATCACATGGTAGAAGGGGTAAGG + Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1033848429 7:145463510-145463532 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1034278741 7:149837292-149837314 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1034362247 7:150510304-150510326 CCCACATGGTGGAAGGGGCGGGG - Intergenic
1034375594 7:150641217-150641239 CAATCATGGTAGAAGGAGAAGGG - Intergenic
1034530565 7:151693749-151693771 CTCACATGGTGGAAGGAGGAGGG - Intronic
1034642769 7:152617943-152617965 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1034712252 7:153203919-153203941 TCCACATAGTAGAAAGACGATGG - Intergenic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1034888934 7:154822360-154822382 CTCACATGGTGGAAGGGGCAAGG + Intronic
1035390034 7:158497534-158497556 CCAAATTGGTAGCAGGAGGAGGG + Intronic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1035897735 8:3422904-3422926 CTCACATGGCAGAAGGAAAAGGG + Intronic
1036290206 8:7481290-7481312 CTCCCATGGTGGAAGGAGCAAGG + Intergenic
1036331271 8:7830230-7830252 CTCCCATGGTGGAAGGAGCAAGG - Intergenic
1036542329 8:9729120-9729142 CTCACTTGGCAGAAGGCGGAAGG + Intronic
1037427742 8:18775014-18775036 ACCAGAAGGTAGGAGGAGGAGGG - Intronic
1037610439 8:20471569-20471591 CTCACATGGAAGAATGAGGATGG - Intergenic
1037642426 8:20758760-20758782 CTTACATGGTGGAAGGTGGAGGG + Intergenic
1037728204 8:21501474-21501496 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1038090987 8:24252762-24252784 TCCCCATGGCAGAAGGTGGAAGG + Intergenic
1038381272 8:27096605-27096627 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1038680436 8:29662509-29662531 CTCACATGGTAGAAGGAGTGAGG + Intergenic
1038924084 8:32118409-32118431 CACTCATGGTAGAAGGTGAAGGG - Intronic
1038926872 8:32150502-32150524 CTCACATGGCAGAAGCAGAAGGG - Intronic
1039099745 8:33928488-33928510 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1040071813 8:43194815-43194837 CTCACATGGTAGAAGAGGCAAGG - Intronic
1040539773 8:48342142-48342164 CTCACTTGGTAGAAGGGGAAAGG - Intergenic
1040558369 8:48501007-48501029 CCCACATGGCAGGATGATGAGGG + Intergenic
1040751863 8:50719345-50719367 CTCCCGTGGCAGAAGGAGGAAGG - Intronic
1040860238 8:51991263-51991285 CACCCATGGCAGAAGGAGAAGGG - Intergenic
1040946273 8:52888023-52888045 CTCATATGGCAGAGGGAGGAAGG - Intergenic
1041212318 8:55564740-55564762 CTCACATGGTGGAAGGAGCGTGG - Intergenic
1041257626 8:55992792-55992814 CTCACATGGAAGAAGGTGGAAGG + Intronic
1041403663 8:57472474-57472496 CTCACATGGCAGAGGGTGGAAGG + Intergenic
1041422893 8:57689353-57689375 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1041517276 8:58714346-58714368 TTTACATGGTAGAAGGAGCAAGG - Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1041862403 8:62529550-62529572 CTCATATGGTGGAAGGGGGAAGG - Intronic
1042096381 8:65220360-65220382 CTCACACGGCAGAAGGTGGAAGG - Intergenic
1042287262 8:67127368-67127390 CTCACATGGTAGAGAGAGCAAGG + Intronic
1042295808 8:67216329-67216351 CTCACGTGGTGGAAGGAGGAGGG - Intronic
1042405199 8:68396806-68396828 CCCTCATGGCAGAAGGTGAAGGG - Intronic
1042411413 8:68470746-68470768 CTCACATGGTGGAAGGGGCAAGG + Intronic
1042449510 8:68928266-68928288 CTCACATGGAAGAAGGCAGAAGG - Intergenic
1042775886 8:72430815-72430837 CTCACATGGTGGAAGGCAGAAGG + Intergenic
1042851142 8:73217165-73217187 CCCACATGGCTGAAGGTGGAAGG - Intergenic
1043217201 8:77606604-77606626 CCCAAATGGAAGAAGCAGCAAGG - Intergenic
1043476916 8:80614176-80614198 GCAAAATGGGAGAAGGAGGAAGG + Intergenic
1043628655 8:82297271-82297293 CTCCCATGGTGGAAGGAGCAAGG + Intergenic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1044348161 8:91130886-91130908 CTCACATGGTAGAAGGGGCAAGG + Intronic
1044510635 8:93074344-93074366 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1044631867 8:94288049-94288071 CTCACATGGCGGAAGGTGGAAGG + Intergenic
1044676678 8:94736128-94736150 CTCACATGGTGGAAGCAGCAAGG + Intronic
1044737821 8:95297235-95297257 CAACCATGGCAGAAGGAGGAAGG + Intergenic
1045030109 8:98127095-98127117 CTCACATGGTGGAAGGAGCGAGG + Intronic
1045059231 8:98397876-98397898 CAATCATGGTAGAAGGTGGAGGG - Intergenic
1045809600 8:106205910-106205932 CTCACATGGTATAAGAAGCAAGG - Intergenic
1045859772 8:106803102-106803124 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1046074182 8:109297530-109297552 CTCACATGACAGAAGGCGGAGGG - Intronic
1046177190 8:110593172-110593194 CTCACATGGTAGAAGAGGCAAGG + Intergenic
1046334702 8:112770326-112770348 CTCATATGGCAGAAGGTGGAAGG - Intronic
1046519515 8:115306396-115306418 CTCACATGGTGGAAGATGGAAGG - Intergenic
1046953378 8:120039185-120039207 CTCACATGGTAGAAGGGGCAAGG - Intronic
1047014641 8:120710653-120710675 CTCACATGGCAGAAGGCAGAAGG - Intronic
1047063246 8:121251179-121251201 CTCACATGGTGAAAGGAGCAAGG - Intergenic
1047145352 8:122192667-122192689 CTCACATGATAGAAGGGTGAGGG + Intergenic
1047252868 8:123193779-123193801 CTCACATGGCAGAAGGAGTGAGG + Intronic
1048146056 8:131844868-131844890 CCCAAAGGGTGAAAGGAGGAGGG - Intergenic
1048302672 8:133262916-133262938 CCCACAAGCTAGAAGGAGCCTGG + Intronic
1048465556 8:134662154-134662176 CTCACATGGTGGAAGGGGCAAGG + Intronic
1048476707 8:134749449-134749471 TTCACATGGTAGAAGGGGCAAGG + Intergenic
1048841966 8:138574539-138574561 CCCACATGGCAGAAAGTAGAAGG + Intergenic
1049111095 8:140643982-140644004 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1049490822 8:142900769-142900791 CTCACATGGTAGAAGTCGGAGGG - Intronic
1049508774 8:143017723-143017745 CCCACACGGGAGTAGGGGGAGGG - Intergenic
1049936748 9:506762-506784 CCCAAGTGGGAGGAGGAGGATGG + Intronic
1050005802 9:1128988-1129010 CTCACATGGAGGAAGGAGAAGGG - Intergenic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1050367277 9:4884264-4884286 CTCACATGGTAGAAGGGGTCTGG + Intronic
1050605397 9:7295960-7295982 CTTACATGGTGGAAGGCGGAAGG - Intergenic
1050759681 9:9052159-9052181 CCCACATGGCAGAAGGGGCAAGG + Intronic
1051004923 9:12332215-12332237 CCAACATGGGAGAAAGATGAAGG - Intergenic
1051266735 9:15316511-15316533 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1051375731 9:16400539-16400561 CCCCCATGGCTGAAGGTGGAAGG + Intergenic
1051602210 9:18886644-18886666 CCCACATGGTGGAAGGGCCAAGG + Intronic
1051662681 9:19440494-19440516 CTCACATGGTAGAAGGGCCAAGG - Intronic
1051910703 9:22152190-22152212 CTCACATAGTAGAAGGGGCAAGG - Intergenic
1051964839 9:22815276-22815298 CTCACATGGTAGAAGGCAGAGGG - Intergenic
1052283239 9:26756226-26756248 CTCACATGGAGGAAGGTGGAAGG + Intergenic
1052378733 9:27746138-27746160 CTCACATGGTGGAAGGAACAAGG - Intergenic
1052944902 9:34160513-34160535 CTCACATGGTGAAAGGAGGAAGG + Intergenic
1053449834 9:38184160-38184182 CCCTCATGGCAGAAGGAGAAGGG + Intergenic
1053628810 9:39908080-39908102 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1053671650 9:40371123-40371145 CTCACATGGTGGAAGGTGGAAGG + Intergenic
1053723359 9:40971972-40971994 CTCACATGGTGGAAGGCGGGAGG - Intergenic
1053777258 9:41558264-41558286 CTCACATGGTGGAAGAGGGAGGG + Intergenic
1053793212 9:41701451-41701473 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1053921461 9:42997492-42997514 CTCACATGGTGGAAGGTGGAAGG + Intergenic
1054151965 9:61613388-61613410 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1054181621 9:61913463-61913485 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1054215077 9:62342622-62342644 CTCACATGGTGGAAGAGGGAGGG + Intergenic
1054364474 9:64320222-64320244 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1054382764 9:64511167-64511189 CTCACATGGTGGAAGGTGGAAGG + Intergenic
1054471737 9:65544518-65544540 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1054512968 9:66005187-66005209 CTCACATGGTGGAAGGTGGAAGG - Intergenic
1054672404 9:67812727-67812749 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1054702237 9:68424406-68424428 CTCACATGGTGGAAGGGGCAAGG + Intronic
1055618206 9:78095105-78095127 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1056365530 9:85900699-85900721 CTCACATGGCAGAAGACGGAAGG + Intergenic
1056423476 9:86453174-86453196 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1056525013 9:87435054-87435076 CATTCATGGTAGCAGGAGGAAGG + Intergenic
1056594749 9:87997780-87997802 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1056674749 9:88665846-88665868 CTCACATGGCTGAAGCAGGAGGG + Intergenic
1056794066 9:89644962-89644984 TTCACATGGTAGAGGGGGGAAGG - Intergenic
1056853332 9:90103173-90103195 TTCACATGGTGGAAGGAGCAAGG - Intergenic
1056987127 9:91373664-91373686 CTCACATGATAGAAGGGGCAGGG + Intergenic
1057035108 9:91806324-91806346 CTCACATGGCAGAAGGAGAAAGG + Intronic
1057339542 9:94187556-94187578 CTCACATAGTGGAAGGTGGAAGG + Intergenic
1057468758 9:95339091-95339113 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1058111981 9:101040782-101040804 CTTACATAGTAGAAGGAGGCCGG - Intronic
1058139276 9:101340851-101340873 CACTCATGGTAGAAGGAGAAGGG + Intergenic
1058140723 9:101354747-101354769 TCCAAAAGGTAGAAGTAGGAAGG + Intergenic
1058188424 9:101883896-101883918 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1058293897 9:103280498-103280520 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1059001703 9:110355476-110355498 CCCACGTGGTAGAACTAGGGAGG - Intergenic
1059599645 9:115762879-115762901 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1059726284 9:117011384-117011406 CTCACATGGTGGAAGGAGTGAGG - Intronic
1059886015 9:118745470-118745492 GCCGCATGGTAGAAGGAACATGG - Intergenic
1059921060 9:119160209-119160231 CTCACATGGTGGAAGGGGCAAGG - Intronic
1060011600 9:120048329-120048351 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1060236935 9:121870964-121870986 CCAGGATGGTGGAAGGAGGAAGG - Intronic
1060332007 9:122681336-122681358 ACCTCATGGTATAAGGTGGAAGG + Intergenic
1060607772 9:124932835-124932857 CTCACATGGTGGAAGGGGCAAGG + Intronic
1062446507 9:136597538-136597560 CCCACATGGGAGCAAGAGCAAGG + Intergenic
1203631210 Un_KI270750v1:74022-74044 CCCACAGGGAATAAGGAGCAGGG - Intergenic
1185828584 X:3276623-3276645 CTCACATGGTAGAAGGGGCAAGG - Intronic
1185845325 X:3432503-3432525 CCCACATGGTGGAAGGGACAAGG + Intergenic
1186027014 X:5324270-5324292 CTCACATGGTGGAAGGGGTAAGG - Intergenic
1186035915 X:5423534-5423556 CTCACGTGGTAGAAGGGGCAAGG - Intergenic
1186146222 X:6626964-6626986 CTCACATAGTAGAAGGGGTAAGG + Intergenic
1186170551 X:6872016-6872038 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1186174513 X:6910908-6910930 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186275316 X:7931982-7932004 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186281571 X:7998796-7998818 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1186331787 X:8542225-8542247 TCCACATGGGAGAGGAAGGAGGG - Intronic
1186462193 X:9757250-9757272 CCCACATGGTAGAAGGGGTGAGG + Intronic
1186716275 X:12255269-12255291 CACACAAGGTAGAAAAAGGAAGG + Intronic
1186787955 X:12971060-12971082 CCCACATGGTGCAAAGAGGAAGG - Intergenic
1186963465 X:14762137-14762159 CTCACATGGTGGAAGGCAGATGG + Intergenic
1186987054 X:15028482-15028504 CTCATATGGTGGAAGGAGCAAGG - Intergenic
1187043179 X:15618199-15618221 CCCAAATGGTGGAAGGGGAAGGG + Intergenic
1187196780 X:17094026-17094048 CCAACATGGGAAAAAGAGGAAGG - Intronic
1187207416 X:17196500-17196522 CTCACATGATGGAAGGAGCAAGG - Intergenic
1187221243 X:17328162-17328184 CTCACATGGTAGAAAGAGCAAGG + Intergenic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1187461217 X:19488907-19488929 CCAAGATGGTAGAAGAGGGAAGG + Exonic
1187515291 X:19964087-19964109 TCCAAATGGTAGAATGGGGAGGG - Intronic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1188076102 X:25776879-25776901 CACAGATGGTACAAGAAGGATGG - Intergenic
1188172401 X:26943636-26943658 CTCACATGGTAGAAAGGGCAAGG - Intergenic
1188295346 X:28440751-28440773 CACACATGGTGGAAGGTGAAGGG - Intergenic
1188351751 X:29140056-29140078 CACTCATGGTAGAAGGTGCAAGG + Intronic
1188593631 X:31869844-31869866 CTCAGATGGTAGAGTGAGGATGG - Intronic
1188827686 X:34856367-34856389 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1188840754 X:35014146-35014168 TGCACATGGTAGAAGGGGCAGGG - Intergenic
1189068372 X:37836353-37836375 CTCACAAGGTGGAAGGAGCAAGG - Intronic
1189068818 X:37842332-37842354 CTCACATGCTAGAAACAGGATGG + Intronic
1189178467 X:38981215-38981237 CACACATGTCAGAAGGAGCAAGG - Intergenic
1189569757 X:42283933-42283955 CTCACATGGCAGAAGGAGCAAGG - Intergenic
1189621153 X:42839755-42839777 CACTCATGGCAGAAGGAGAAGGG + Intergenic
1189858741 X:45250847-45250869 CACTCATGGTAGAAGGTGAAAGG + Intergenic
1189916163 X:45857749-45857771 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1190013207 X:46803370-46803392 CTCACATGGTGGAACGTGGAAGG - Intergenic
1190164025 X:48056706-48056728 CTCACATGGCAGAAGGCAGAAGG - Intronic
1190916880 X:54817598-54817620 CCCAGATGGTGGCAGGAGGTGGG + Intergenic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1192342372 X:70274743-70274765 CTCACATGGTGGAAGGTGGAAGG + Intronic
1192824215 X:74678256-74678278 CTCACATGGTGGAAGGCAGAAGG + Intergenic
1193698097 X:84734327-84734349 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193903420 X:87212770-87212792 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193984150 X:88219936-88219958 ACCACATGGTAGAAGGTGAAAGG + Intergenic
1194465951 X:94235891-94235913 CCCACAAGGTAGAAGGAATTGGG - Intergenic
1194794141 X:98188933-98188955 CTCACATGGTGGAAGGTGGAAGG - Intergenic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1195307462 X:103598450-103598472 CTCACATGGTAGAAGAGTGAGGG - Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1195454755 X:105055221-105055243 CTCACATGGCAGAAAGAGCAAGG + Intronic
1195627379 X:107018387-107018409 CTCACATGGTAGAAGGACAAAGG + Intergenic
1195808234 X:108799673-108799695 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1195980073 X:110568161-110568183 CCCACCTGGAAGCAGGAGAATGG + Intergenic
1196058221 X:111378932-111378954 CTCACATGGCAGAAGGCAGAAGG - Intronic
1196076738 X:111586073-111586095 CTCACATGGTGGAAGGAACAAGG - Intergenic
1196130895 X:112155022-112155044 CTCACATGGCAGGAGGTGGAGGG - Intergenic
1196321373 X:114344385-114344407 CTCACATGGCAGAAGGTTGAAGG - Intergenic
1196327155 X:114420028-114420050 CTCACATGGTAGAAGGGCAAAGG - Intergenic
1196362190 X:114875125-114875147 CTCACATGGTAGAAGAGGTAAGG + Intronic
1196538182 X:116872470-116872492 CTCACATGACAGAAGGTGGATGG + Intergenic
1197747237 X:129939837-129939859 CCAACATGGCAGGAGCAGGAAGG + Intergenic
1198194308 X:134344646-134344668 TCCTCATGGTGGAAGGTGGAAGG - Intergenic
1198299482 X:135321097-135321119 CTCACATGGTATAAGGTAGAAGG + Intronic
1198455355 X:136812215-136812237 CTCACATGGTGGAAGGAGCCAGG + Intergenic
1198742747 X:139858089-139858111 GCCCCATGGCAGAAGGTGGAAGG - Intronic
1199234983 X:145481233-145481255 CCCACATGGCAGAAGGGGCAGGG + Intergenic
1199530642 X:148843775-148843797 CCCACATGGTAGAAGGGGTGAGG + Intronic
1199753775 X:150845736-150845758 CTCCCATGGTATAAGGTGGATGG + Intronic
1199884095 X:152001916-152001938 CTTACATGGTAGAAGGGGCAAGG - Intergenic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200167807 X:154049421-154049443 CTCACATGCTAGGAGGAGCAGGG - Intronic
1200818675 Y:7560177-7560199 GCCACATGGTAGACGGACCACGG - Intergenic
1200842322 Y:7795385-7795407 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic
1201430828 Y:13900393-13900415 TCCACATGGGAGAGGAAGGAGGG + Intergenic
1201446686 Y:14064600-14064622 CTCACATGGTAGAAGGGGAAAGG - Intergenic
1201451651 Y:14121919-14121941 CTCACAGGGTGGAAGGAGCAAGG - Intergenic
1201511158 Y:14764705-14764727 CCCACATGGGAAAAGGGTGAGGG + Intronic
1201673836 Y:16557122-16557144 CTCACATGGTAGAAGGGGTGAGG - Intergenic
1201688197 Y:16731440-16731462 CTCACATGGTAGAAGGGGCCAGG + Intergenic
1201746884 Y:17385945-17385967 CTCAAATGGTAGAAGGGGCAGGG - Intergenic
1201906412 Y:19090256-19090278 CTCACATGGTGGAAGGAACAAGG - Intergenic
1201912882 Y:19151359-19151381 TTCACATGGTAGAAGGGGGCAGG + Intergenic
1202363720 Y:24139294-24139316 CTCACATGGTAGCAGGCAGAAGG + Intergenic
1202507060 Y:25530823-25530845 CTCACATGGTAGCAGGCAGAAGG - Intergenic