ID: 1078067999

View in Genome Browser
Species Human (GRCh38)
Location 11:8090364-8090386
Sequence AGCTGAGTAGGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 582}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078067991_1078067999 -8 Left 1078067991 11:8090349-8090371 CCAGCCCAGGCAGACAGCTGAGT 0: 1
1: 0
2: 4
3: 24
4: 275
Right 1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 55
4: 582
1078067989_1078067999 10 Left 1078067989 11:8090331-8090353 CCAGGCTGTGTATGGCTTCCAGC 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 55
4: 582
1078067986_1078067999 25 Left 1078067986 11:8090316-8090338 CCTGACGGGGGATGCCCAGGCTG 0: 1
1: 0
2: 0
3: 14
4: 178
Right 1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 55
4: 582
1078067988_1078067999 11 Left 1078067988 11:8090330-8090352 CCCAGGCTGTGTATGGCTTCCAG 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 55
4: 582

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078067999 Original CRISPR AGCTGAGTAGGGAGGGCAGA GGG Intronic
900204726 1:1427083-1427105 GGCTGAGCAGGGCGGGAAGAGGG - Intronic
900387314 1:2416546-2416568 AGCTGGGGAGGGTGGGCAGCGGG + Intergenic
900615564 1:3564193-3564215 AGCTGAGTCGGGGGTGCAGAAGG + Intronic
900983557 1:6060141-6060163 AGCAGAGGCAGGAGGGCAGATGG - Intronic
901143638 1:7051433-7051455 AGCTGCGTGGGGTGGGCAGGTGG + Intronic
901163023 1:7194721-7194743 AGCTTAGTAAGGAGAGGAGAGGG + Intronic
901538900 1:9901956-9901978 GGCTGGGTAGAGAGGGCAAAGGG - Intronic
901672621 1:10865111-10865133 AGGGGAGCAGGGAGGGGAGAAGG + Intergenic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
901910917 1:12457281-12457303 GGCAGAGGAGGGAGAGCAGAAGG - Intronic
902232391 1:15036286-15036308 AGCTGGGCGGGCAGGGCAGAGGG - Intronic
902439737 1:16421610-16421632 GGCTGAGAGGGGAGGGCAGGGGG - Intronic
902564981 1:17305521-17305543 AGCTGGGCAGGGAAGGCTGAGGG - Intergenic
902959601 1:19953767-19953789 AGCAGAGTTGGGAGGCCACATGG - Intergenic
903189341 1:21648065-21648087 AGCTGGGAAGGGAGGGCCTAGGG + Intronic
903232745 1:21931745-21931767 GGCTCAGGAGGGAGGGCAGGAGG - Intronic
903331097 1:22597633-22597655 AGGTGTGGAGGGAGGGCAGTGGG - Intronic
903471910 1:23593193-23593215 AGGTGATTGGGCAGGGCAGATGG + Intronic
903750711 1:25618505-25618527 AACTGTGTAGGGAGGAAAGAAGG - Intronic
904208120 1:28868107-28868129 ATGCGAGTAGGGAGGGCAGGAGG + Intergenic
904314272 1:29650226-29650248 AGATGAGTCAGGAAGGCAGAGGG - Intergenic
904384926 1:30134969-30134991 AGATGAGTCAGGAAGGCAGAGGG + Intergenic
904396529 1:30225988-30226010 AGCAGACTAGGGAGGGAAAAAGG - Intergenic
904621297 1:31776884-31776906 ATCTGGGGAGGCAGGGCAGAGGG + Intergenic
905815752 1:40949446-40949468 AGGTAAGGAGGGAGGGCAAAGGG + Intergenic
906078591 1:43069218-43069240 AGCTGCAGGGGGAGGGCAGAGGG - Intergenic
906144533 1:43552013-43552035 AGCAGAGAAGGGACGGCAGATGG - Intronic
906205343 1:43983638-43983660 TGCTGAGAAGGGAAGGCAAAAGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907243454 1:53093079-53093101 AGCTCAGTGGGGAACGCAGAGGG - Intronic
907872613 1:58456543-58456565 GGCTGAGTGAGGACGGCAGAAGG + Intronic
908267497 1:62393848-62393870 AGCTGAGAAAGTAGAGCAGAGGG - Intergenic
909132438 1:71754637-71754659 AGCTGAATAGGGAATGCAGGTGG - Intronic
910036582 1:82796271-82796293 AGCTGAGCTGGAAGGGGAGAAGG + Intergenic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
912155131 1:106908951-106908973 AGCTGGCTAGGGAGGGAAGAGGG + Intergenic
912572083 1:110632123-110632145 ACCTGAGTGGGGAGTGCAGTGGG + Intergenic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
913976677 1:143464004-143464026 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914071078 1:144289621-144289643 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914108077 1:144676734-144676756 AATTACGTAGGGAGGGCAGAAGG - Intergenic
914826861 1:151143287-151143309 AACTGAGTAGGGAGGAGAGTTGG + Intronic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
915507203 1:156365458-156365480 GGCTGAGCAGGAAGGGCAAATGG - Intronic
915581683 1:156816601-156816623 AGCCCAGGAGGGAGGGCAGGGGG + Intronic
915835943 1:159174720-159174742 ATGTGAGAAGGAAGGGCAGATGG - Intronic
915847681 1:159285097-159285119 AGGTGAGTTAGGAGGGGAGATGG + Intergenic
916353199 1:163875627-163875649 ACAAGAGTAGGGAGGGCGGAAGG + Intergenic
916668485 1:166989537-166989559 GGGTGAGGCGGGAGGGCAGAAGG + Intronic
916992524 1:170259609-170259631 AGCTAAGTCGGGAGGGCACCTGG - Intergenic
917359358 1:174159501-174159523 AACTGAGAGGGGAGGGGAGAAGG - Exonic
917482920 1:175427869-175427891 AGCGAAGAAGGGAGGGAAGAAGG - Intronic
918215971 1:182392025-182392047 AGCGGAGCCGGGAGGGCTGAGGG + Exonic
918276269 1:182956123-182956145 AGCAGGGCAGGGAGTGCAGAAGG + Intergenic
918339064 1:183552255-183552277 AGCTGAGAAGGGAAGGCAGATGG + Intronic
918423375 1:184386326-184386348 GGCTGAGAAGGGTGGGGAGAGGG + Intergenic
919593883 1:199537951-199537973 ACCTGAGTATGGAGTGTAGAGGG - Intergenic
919803796 1:201368929-201368951 ACCTGGGAAGGGAGGACAGAGGG - Intronic
920116665 1:203626570-203626592 AGCTGAGTAGGGGTGGAGGAGGG - Exonic
920219205 1:204383948-204383970 AGATGAGGATGGAGGGTAGAGGG + Intergenic
920372313 1:205486871-205486893 GGCTGAGGAGTGAGGGCAAAGGG - Intergenic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920958233 1:210639207-210639229 GGATGAGTTGGGAGGACAGAAGG - Intronic
920976347 1:210789235-210789257 AGCTGAGTATGGAGAGGAGGGGG - Intronic
921034902 1:211367620-211367642 AGCTGAGTAGGGAGGGGACATGG + Intronic
921110017 1:212026644-212026666 AGCTGAGGATGGAGGTGAGAAGG + Intronic
921320154 1:213930909-213930931 AGCTGTGTAGGAAGTGTAGAAGG - Intergenic
922170467 1:223150332-223150354 AGCTGAGTGAGGAGGGAGGATGG - Intergenic
922296798 1:224257045-224257067 AGCTGGGTTGAGAGGGCAAAAGG - Intronic
922447344 1:225708536-225708558 AGCTGAGAAAGAAGGACAGATGG + Intergenic
922896233 1:229102647-229102669 AGGTGAGCGGGGAGGGGAGAAGG - Intergenic
923140047 1:231153758-231153780 AGGTGAGGAGGGAGGGCTGAGGG - Intergenic
923614334 1:235524434-235524456 AGGCGGGGAGGGAGGGCAGAAGG + Intergenic
924219168 1:241855570-241855592 GGCTGAGGAGTGCGGGCAGACGG - Intronic
924258473 1:242205770-242205792 CACTGAGCAGGGATGGCAGATGG + Intronic
924365286 1:243286444-243286466 AGGCGAGGAGAGAGGGCAGAAGG - Intronic
924402807 1:243705607-243705629 AGGTGAGTAAGGAAGGCACAGGG + Intronic
1063562008 10:7137309-7137331 AGATGAATAGGGATGGCAGCAGG - Intergenic
1064269128 10:13849367-13849389 AACTGAGTAGTGTGGGCAGGTGG - Intronic
1064328229 10:14370674-14370696 AGCTGAGAAGGGGCTGCAGAGGG - Intronic
1064473199 10:15658445-15658467 AGCTGAGGACGGAGGGGACAGGG - Intronic
1065645017 10:27825046-27825068 AGCTGAGTAGGGGAGGCTGTGGG - Intronic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1066517335 10:36177539-36177561 AGCAGAGTAGGGAAAGAAGAAGG + Intergenic
1067086457 10:43243013-43243035 AGATGGGTCGGGCGGGCAGAGGG - Intronic
1067517812 10:46968553-46968575 AACTGAGTGAGGAGGACAGAAGG - Intronic
1067644438 10:48083276-48083298 AACTGAGTGAGGAGGACAGAAGG + Intergenic
1067663921 10:48257087-48257109 AGCTGAGGAATGCGGGCAGATGG - Intronic
1067808966 10:49412404-49412426 TGCTGAGTAGGGTGAGCAGTGGG - Intergenic
1067921676 10:50464815-50464837 AGGGGAGGAGGGAGGGAAGAAGG + Intronic
1067999758 10:51318607-51318629 TGCAGAGTAGGGAAAGCAGAGGG + Intronic
1068685755 10:59868568-59868590 ACCTCAGTAGGGAGGGCACCAGG - Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070577513 10:77690513-77690535 AGCAGGCTAGGGAGGGCAGCAGG + Intergenic
1070627512 10:78061805-78061827 AGCAGAGTATGGATGGCACAGGG - Intergenic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1070844835 10:79513472-79513494 GGATGAGTGGGGAGGGCACAAGG - Exonic
1070928970 10:80246835-80246857 GGATGAGTGGGGAGGGCACAAGG + Intergenic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071494073 10:86155764-86155786 AGGGGAATAGGGAGGGCAGGAGG + Intronic
1071515580 10:86294581-86294603 AGCACTGGAGGGAGGGCAGATGG + Intronic
1071886091 10:89952010-89952032 AGCTGAGCAGGGGTGGCTGAGGG - Intergenic
1072934661 10:99700642-99700664 ACATGAGCAGGGAGAGCAGATGG - Intronic
1073431418 10:103489922-103489944 AGCAGAGAAGGAAGGGCAGGGGG + Intergenic
1073855109 10:107664441-107664463 AGCTGAGGAGGAAGGGGAGCTGG - Intergenic
1074078373 10:110149607-110149629 TGCTGAGAAGGGAGGGGAGTAGG - Intergenic
1074509762 10:114101389-114101411 TGCAGAGTGGGGAGGGAAGAAGG + Intergenic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1075470223 10:122683251-122683273 AGCTGAGCAGGGAGAGGAGGTGG - Intergenic
1075841505 10:125508581-125508603 GGCTGAGTAGGGAGGCTGGAAGG - Intergenic
1076266051 10:129110667-129110689 AGCAGGGTAGAGAAGGCAGAGGG + Intergenic
1076638479 10:131898894-131898916 ACCTCAGGAGGGAGGACAGATGG - Intergenic
1076643783 10:131937344-131937366 AGCTGAGCCTGGAGGGCAGTGGG - Intronic
1076725182 10:132409766-132409788 TGCTGAGAAGGAAGGGAAGAGGG + Intronic
1077013041 11:387845-387867 ACCTGAGTAGGGAGGAGTGAAGG - Intergenic
1077138885 11:1014839-1014861 AGCTGGGAGGGGAGGGCAGCTGG - Intronic
1077644600 11:3912206-3912228 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1078052131 11:7974957-7974979 AGCTTTGCAGGGAGGGAAGAAGG + Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078102132 11:8336225-8336247 AGCTGAGGAAGGAGGGCCAATGG + Intergenic
1078146081 11:8722654-8722676 ACCTGACTAGGGAGGCCAGAGGG - Intronic
1079102640 11:17551457-17551479 AGCTGAGTTGTGAGGACAGTGGG + Intronic
1079949254 11:26781424-26781446 AGATTAGAAGGGAGGGAAGAAGG + Intergenic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1080485678 11:32704487-32704509 AGCACAGGAGGGAGGCCAGAGGG + Intronic
1080600884 11:33819811-33819833 GGCTGAGGAAGGAGGGCACAAGG - Intergenic
1080693995 11:34584911-34584933 ATATGAGTTGGGAGTGCAGAGGG + Intergenic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1083123583 11:60540180-60540202 AGCTGAGTAGTTATGACAGATGG - Intronic
1083262498 11:61530821-61530843 AGCTGAGTAAGTAGGGCTCAGGG - Intronic
1083925604 11:65804213-65804235 TGCTGGTTAGGGAGGGCAGGAGG - Intergenic
1084125562 11:67096759-67096781 GGCAGAGTTGGGAGGGCAGGAGG - Intergenic
1084557886 11:69885706-69885728 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084557904 11:69885748-69885770 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084587849 11:70073570-70073592 AACTGAGGATGGTGGGCAGAAGG + Intergenic
1085652891 11:78284488-78284510 AGCAGAATAGGCAAGGCAGAGGG - Intronic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1086311507 11:85540496-85540518 AGGTGAATGGGGAGGCCAGAGGG - Intronic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086477840 11:87198554-87198576 AGCGGAGAGGGGAGGGGAGAGGG - Intronic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1087296108 11:96376227-96376249 AGACCAGTAGGAAGGGCAGATGG - Intronic
1087909282 11:103734727-103734749 AGCTGACTAGGAAGGGTGGAGGG + Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1089202245 11:116731562-116731584 AGGTGAGCAGGGAGAGAAGATGG + Intergenic
1090208607 11:124899489-124899511 AGCTGAGGACAGAGGGCAGTGGG + Intergenic
1090915762 11:131160682-131160704 AGCCGAGCAGGGAGGGATGAGGG - Intergenic
1090924219 11:131235522-131235544 AGCGGAGCAGGCAGGGCAGTGGG - Intergenic
1090929370 11:131281651-131281673 AGATGAGAAGAAAGGGCAGAAGG - Intergenic
1091338798 11:134794582-134794604 AACTGAGTCTGGAGAGCAGAGGG + Intergenic
1092208924 12:6633793-6633815 AGCAGAGTAGGGAGAGCAGATGG + Intronic
1092598069 12:10029612-10029634 TGCTGAGTAGGTAGGGCACAGGG - Intergenic
1093345693 12:18036673-18036695 AGCTGAAGAGAGAAGGCAGAAGG + Intergenic
1094218378 12:27969560-27969582 AGCGGAGTAGTGCGGGGAGATGG - Intronic
1096413838 12:51395681-51395703 AGGTTAGTAGGGAGGCCAGCTGG + Intronic
1096829260 12:54301539-54301561 GGCTGAGGGGGGAGGGGAGAAGG - Intronic
1097222691 12:57460200-57460222 AGGTGAGAAGGGGGGGCAGGCGG + Exonic
1097478628 12:60091978-60092000 AGCTGAGTTGGGTGTGCAGGAGG + Intergenic
1100396926 12:94193807-94193829 TACTGAGTAGGGAGTGTAGAAGG + Intronic
1100406250 12:94275134-94275156 TTCTGAGTAGGGAGGACAGTGGG - Intronic
1100676887 12:96878227-96878249 AGCTGAGCAGGGATTGCAGGAGG - Intergenic
1100691771 12:97046064-97046086 AGCAGAGAAAGGAGGGCAGAAGG - Intergenic
1100891432 12:99130582-99130604 GGATGAGTAGAGAGGGAAGAAGG - Intronic
1101752792 12:107596745-107596767 AGGAGAGTAGGGAGGGAAGGAGG - Intronic
1101820334 12:108179255-108179277 AGCGGGGGAGGGGGGGCAGAGGG + Intronic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1102454959 12:113065528-113065550 AGAGGAGGAGGGAGGGAAGAAGG - Intronic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG + Intronic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1103737757 12:123071151-123071173 TCTTGAGTAGGGTGGGCAGAGGG + Intronic
1103827725 12:123753436-123753458 AGCTGAGCAGGGAGGCCTCAGGG - Intronic
1103898742 12:124292272-124292294 AGCGCTGTAGGAAGGGCAGAGGG - Intronic
1104488404 12:129172474-129172496 AGCTGAGTGAGGAAGGCAGATGG - Intronic
1104544411 12:129698552-129698574 AGGGGAGAAGGGAGGGGAGAAGG + Intronic
1104544417 12:129698564-129698586 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1104856281 12:131903869-131903891 AGCACAGTGGGGAGGGCAGAGGG + Intronic
1104939165 12:132386819-132386841 GGCTGAGAAGGGAGGGCCGTGGG - Intergenic
1105222556 13:18345815-18345837 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1105584756 13:21733734-21733756 AGTAGAGTGGTGAGGGCAGAAGG + Intergenic
1106028075 13:25974080-25974102 AGCAGAGAAGCGAGTGCAGACGG + Intronic
1106154055 13:27135820-27135842 AGCTAGCTAGGGAGGGGAGAAGG + Intronic
1106179967 13:27362109-27362131 TGAGGAGTAGGGAGGGCAGTGGG + Intergenic
1106245107 13:27942562-27942584 AGCTGAGTTGTGAGAGCAGTGGG + Intergenic
1106830798 13:33580384-33580406 GGCTTAGTGGGGAGGGGAGAAGG + Intergenic
1107285534 13:38786209-38786231 AGCTGGGAAGGGAGGAAAGATGG - Intronic
1107836183 13:44413945-44413967 GGCTGAGGAGTGAGGGCACACGG + Intergenic
1110906113 13:80891921-80891943 AACAGAGTAGGGAAGACAGAGGG - Intergenic
1111249888 13:85589237-85589259 AGCTGAGTTGGGTGTGCAGGAGG + Intergenic
1112211371 13:97380850-97380872 GGCTTACTGGGGAGGGCAGATGG + Intronic
1112728271 13:102329846-102329868 AGCTGAGAAGTGAGGGCATAAGG - Intronic
1113758771 13:112833123-112833145 AGCTCAGTGTGGAGGGCACAGGG - Intronic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1115176247 14:30564431-30564453 AGCTGAGGTGGGAGGACAGCTGG - Intronic
1116905336 14:50397755-50397777 AGCTGAGGAGAGAGGGCTGGTGG + Intronic
1117432729 14:55685510-55685532 GGCAGAATAGGGAGGGCAGAAGG - Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1119394962 14:74319451-74319473 AGCTCAGTTGGTAGAGCAGAGGG - Intronic
1119678389 14:76573444-76573466 AGACCTGTAGGGAGGGCAGAGGG + Intergenic
1119931453 14:78551656-78551678 AGGTGAGGAGGGAGGGGAGGAGG - Intronic
1120864736 14:89286157-89286179 AGAGGAGTAGGGAGGGGAGGAGG + Intronic
1120864743 14:89286181-89286203 AGAGGAGTAGGGAGGGAAGAAGG + Intronic
1121284556 14:92725216-92725238 AGATTAGGAGGGAGGACAGAGGG - Intronic
1121367066 14:93322997-93323019 ACCTGAGTAGCTAGGGCAGCAGG - Intronic
1121489819 14:94349773-94349795 AGCTGAGAAGGGAAGGATGAAGG + Intergenic
1121732125 14:96194307-96194329 TGCTGCATAGGGAGGGCAGAAGG + Intergenic
1122297480 14:100713551-100713573 TGCGGAGAAGTGAGGGCAGAAGG + Intergenic
1122428131 14:101623447-101623469 AGCTCAGGAGGCAGGGGAGAAGG + Intergenic
1122965048 14:105119571-105119593 AGCCAAGTTGGGAGGTCAGAAGG + Intergenic
1125201915 15:37107484-37107506 CGCCGGGTAGGGAGGTCAGAGGG + Intergenic
1125421959 15:39512806-39512828 AGCAGAGCAGGGAGGGAAAAGGG + Intergenic
1125721983 15:41849574-41849596 AGCCGAGCAGGAAGGGCACAGGG + Intronic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1127264436 15:57350107-57350129 AGTTGAGTAAGAAGGACAGAGGG - Intergenic
1128084966 15:64879529-64879551 AGGTGAGGAGGGAGGAGAGATGG + Intronic
1128135635 15:65261266-65261288 AACTGAGTGGGGAGAACAGAAGG + Intronic
1128162587 15:65434099-65434121 AGCTGAGGAGGGAGAGCAGGAGG - Intergenic
1128684702 15:69675067-69675089 AGCTGAGTAGGGGAGCCAGGTGG - Intergenic
1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG + Intergenic
1128762446 15:70226572-70226594 AGCTGAGAAGGAGGGGCAGCAGG - Intergenic
1129088207 15:73119710-73119732 TTCTGAGTAGGGAAAGCAGATGG - Intronic
1129373948 15:75115986-75116008 AGCTGAGGAGTGCGGGCACACGG - Intronic
1129682794 15:77667404-77667426 AGCAGAATAGGGAGGGGCGAGGG + Intronic
1130096592 15:80860808-80860830 AGCTGTGTGGTGAGGTCAGAGGG - Intronic
1131665654 15:94568551-94568573 AGAGGAGGAGGCAGGGCAGAGGG + Intergenic
1131933937 15:97480141-97480163 ACTTGAGTGGGGAGGGTAGAAGG + Intergenic
1133399890 16:5478018-5478040 AGCTCAGTAGGGAGGGATCAGGG + Intergenic
1133470086 16:6066646-6066668 AGCTGAGCAGAAAGGGCAGGTGG + Intronic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1134680871 16:16124599-16124621 CGCAGGGTAGGGAGGGCCGAAGG - Intronic
1134747642 16:16600484-16600506 AGCAGGGGAGGGAGGGCAGAGGG - Intergenic
1134754631 16:16655867-16655889 AGCTGAGGAGGAATGGCAGCGGG - Intergenic
1134991430 16:18703175-18703197 AGCTGAGGAGGAATGGCAGCGGG + Intergenic
1134997825 16:18753175-18753197 AGCAGGGGAGGGAGGGCAGAGGG + Intergenic
1138519294 16:57561902-57561924 AGCTGAGGATGAAGGGCAAAGGG - Intronic
1139158853 16:64478547-64478569 AGCTGAGTCCAAAGGGCAGAGGG + Intergenic
1139222237 16:65195435-65195457 GGCTGAGTAGGGAGAGGGGATGG - Intergenic
1139958096 16:70702759-70702781 AGCTGGGGAGGGAGGAAAGAGGG + Intronic
1140476062 16:75239768-75239790 AGCTGGGGAGGGAGGGGAGCGGG - Intronic
1141373559 16:83509037-83509059 GAATGAGAAGGGAGGGCAGAGGG - Intronic
1141382687 16:83589953-83589975 AAATGTGCAGGGAGGGCAGAGGG + Intronic
1141766695 16:86063786-86063808 GCCTGAGCAGGGAGGGTAGAGGG + Intergenic
1141853024 16:86660451-86660473 AGCTGAGTCTGCAGGGCAGGTGG - Intergenic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142223457 16:88866240-88866262 AGCTGACTTAGGAGGGGAGAGGG - Intronic
1142567590 17:850654-850676 AGCTGAGTCAGGAGGGACGAAGG + Intronic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142805148 17:2367542-2367564 GGCAGATCAGGGAGGGCAGAAGG + Intronic
1143126787 17:4646854-4646876 AGCTGAGCAGGGACAGGAGAGGG + Intergenic
1143495823 17:7312173-7312195 GGATGAGTGGGGAGGGCACAAGG - Exonic
1143733644 17:8895471-8895493 AGCAGGGTCAGGAGGGCAGAGGG - Intronic
1144215968 17:13055822-13055844 AGCTGATGAGGGAGGGGAGATGG + Intergenic
1144430961 17:15191434-15191456 AGCAGATGAGGGAAGGCAGAAGG + Intergenic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145748214 17:27336275-27336297 AGCTGGGTAGGGAGATTAGAGGG - Intergenic
1146734311 17:35224555-35224577 AACTGAGGAGGAAAGGCAGAGGG - Intergenic
1146791033 17:35750642-35750664 AGCTGAGTGGGGAGAGGGGAAGG - Intronic
1147120854 17:38334371-38334393 GGCTGAGGAGTGAGGGGAGAAGG + Intronic
1147382797 17:40065629-40065651 GGCTGCGCAGGGGGGGCAGAGGG - Intronic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1148333981 17:46829525-46829547 ACCTGAGAATGAAGGGCAGAGGG - Intronic
1148459689 17:47831998-47832020 AGGTGAGTAGGGAGGTGGGACGG + Exonic
1148737044 17:49870824-49870846 GGCTGAGCAGGAAGGGGAGAGGG - Intergenic
1148739013 17:49881305-49881327 AGATGATGAGGGAGGGGAGAAGG - Intergenic
1148973545 17:51506206-51506228 AGTTGAATAGAGAGGGGAGATGG + Intergenic
1149209705 17:54288895-54288917 AGCTGCTCAGGGAAGGCAGAAGG - Intergenic
1149912305 17:60577764-60577786 AGCTGAGGAGGGAGGGTGGATGG + Intronic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150947790 17:69765895-69765917 AGGGGAGCAGGGAGGGGAGAAGG - Intergenic
1151272485 17:73007668-73007690 AGCTAAGGAGGGAGGGAAGGAGG + Intronic
1151347916 17:73514617-73514639 AGCTTATTCTGGAGGGCAGATGG - Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151671028 17:75571789-75571811 TGCTGGGCAGGGAGAGCAGAGGG + Intronic
1151674904 17:75592337-75592359 CCCAGAGTAGGAAGGGCAGAGGG + Intergenic
1151774940 17:76194205-76194227 AGTTGACTAGAGAGGGCACAAGG - Intronic
1151883450 17:76909249-76909271 AGCAGAGTAGGCCGGGCACATGG - Intronic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1152075778 17:78158861-78158883 GGATGAGTGGGGAGGGCACAAGG - Intronic
1152458833 17:80430914-80430936 AGCTGAGGAGTGGGGGCAAAGGG + Intronic
1152464203 17:80456599-80456621 TGCTCAGCAGGGAGGGCTGATGG - Intergenic
1152843237 17:82583736-82583758 AGCTGCTTAGAGAGGGCAGCTGG + Intronic
1152994640 18:395268-395290 AGTTGAGCTGGGAGGGCACAGGG + Intronic
1153039684 18:800554-800576 AGCTTATTAGGGAGGACAAAGGG + Intronic
1153082670 18:1246995-1247017 AGCTGAGTTGGGTGTGCAGGAGG + Intergenic
1154079549 18:11242885-11242907 AGCAGAGTAAGGAGCACAGAGGG + Intergenic
1154378022 18:13824719-13824741 ATCTGAGTTTGGAGGGCAAAGGG + Intronic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1155403149 18:25460386-25460408 AGCTGAGTGGGGAGACAAGAAGG - Intergenic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156555506 18:38063339-38063361 AGATGAGAAGGGAGGGCACCAGG + Intergenic
1156812934 18:41274194-41274216 AGCTGGGGGGAGAGGGCAGATGG + Intergenic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1157890487 18:51411333-51411355 AGCTGTGTAGGGAGGGCTGTGGG + Intergenic
1158453354 18:57586387-57586409 CGCGGAGAAGGGAGGGCTGAGGG - Intronic
1159588261 18:70302658-70302680 AGCTGAGTAGGAAGGGAAGAGGG + Intronic
1159935343 18:74361283-74361305 GGCGGAGTAGGGAGGGAGGAAGG + Intergenic
1159973768 18:74685441-74685463 TGCTGAGGAGGGAGGACAGAGGG - Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160831095 19:1105148-1105170 AGCTGAGCAGGGAGCGTGGACGG - Intronic
1160944165 19:1633463-1633485 GGATGAGCAGGGAGGGCAGGGGG - Intronic
1161022363 19:2016066-2016088 AGGGGAGGAGGGAGGGGAGAAGG + Intronic
1161447863 19:4328234-4328256 AGCTGGGCAGGGAGGGCTGGGGG - Intronic
1162480562 19:10924652-10924674 AGCTTGGCAGTGAGGGCAGAGGG - Intronic
1163143977 19:15368609-15368631 AGCAGAATGGGGAGGACAGAGGG - Intronic
1163244752 19:16086539-16086561 AGGTGAGTGGGGCTGGCAGATGG + Exonic
1164615264 19:29663871-29663893 AGCTGAGAAGGGAAGGGAAAGGG - Intergenic
1164626023 19:29728653-29728675 AGCTGAGGAGGGAGGCGAGGAGG - Intergenic
1165486594 19:36100423-36100445 ACCTGACTGGGAAGGGCAGAAGG - Intronic
1165574050 19:36798990-36799012 AGCTCGGCAGGGAGGTCAGAGGG - Intergenic
1165752394 19:38268194-38268216 CTCTGAGTAGTGAGGGCAGGTGG + Intronic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1165949554 19:39466459-39466481 ACCTGAGCAGGGCGAGCAGAAGG - Exonic
1166228793 19:41413669-41413691 AGATGAGGAGGGAGAGGAGATGG - Intronic
1166321463 19:42021804-42021826 AACTGAGAAAGGAGGGCACAGGG + Intronic
1166326518 19:42054218-42054240 GGAAGAGCAGGGAGGGCAGAGGG + Intronic
1166370121 19:42295646-42295668 ACCCAAGTTGGGAGGGCAGAGGG - Exonic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1166778058 19:45324183-45324205 ATCTGAGGGGGGAGGGGAGAGGG + Intergenic
1166862359 19:45817762-45817784 AGGTGATGAGGGAGGGCAGCTGG - Intronic
1166979668 19:46625124-46625146 AGCTGAGGAGGGTGGGAAGGAGG - Intergenic
1167349917 19:48968187-48968209 AGTTGAGAGGGGAGGGCAGGAGG - Exonic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167724421 19:51200802-51200824 AGCTGAGTAGGGAAGGGACAGGG - Intergenic
1167794008 19:51697373-51697395 AGCAGAGTGGGGTGGGCATAAGG + Intergenic
1168339984 19:55617152-55617174 AGCAGAGTTGGGAGGGCACAAGG + Exonic
925585635 2:5461436-5461458 AGCTGAGTGGGCAAGGCACAAGG + Intergenic
926071108 2:9892471-9892493 AGCTGAGGAGGGAGGGAATGCGG - Intronic
926168393 2:10535769-10535791 GGCAGAGTGCGGAGGGCAGATGG + Intergenic
928280067 2:29938143-29938165 ACCTGAGAAGGGAGGGCAGGGGG + Intergenic
929554437 2:42916573-42916595 GGCTGAGTAGGGAGGGCAATTGG + Intergenic
929603787 2:43221346-43221368 AGCTGAGCATGGAGGGGAGGGGG - Intergenic
929879985 2:45827114-45827136 AGCAGAGTGTGGAGGGCAGTTGG - Intronic
932750249 2:74366920-74366942 TCCTGAGTAGGGTGGGCAGGAGG - Exonic
933438724 2:82282591-82282613 AGATGGATAGGGAGGCCAGAAGG + Intergenic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
934181377 2:89624967-89624989 AATTACGTAGGGAGGGCAGAAGG + Intergenic
934291679 2:91699209-91699231 AATTACGTAGGGAGGGCAGAAGG + Intergenic
934558645 2:95300830-95300852 AGCTGAGGTGGCAGGTCAGAGGG - Intronic
935152548 2:100450695-100450717 AGCAGAGAAGGGAGGGGAGGGGG - Intergenic
935282920 2:101534557-101534579 AGGGGGGTAGGGAGGGCAGGTGG + Intergenic
935495099 2:103771090-103771112 ATCTGCATAGTGAGGGCAGAAGG + Intergenic
935999363 2:108811143-108811165 AGGGGGGTAGGGAAGGCAGAGGG - Intronic
936015850 2:108958548-108958570 CGCACAGTAGAGAGGGCAGAAGG + Intronic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
936400926 2:112163940-112163962 AGATGTCTGGGGAGGGCAGAGGG - Intronic
936699405 2:114992587-114992609 AGCTGTGTGGGGAGTGGAGAGGG - Intronic
937159614 2:119747590-119747612 AGCTGGGTGGGGAGGGTGGAAGG + Intergenic
937228020 2:120380912-120380934 AGTTGAGGAGGGAAGGCTGAGGG - Intergenic
937845364 2:126573440-126573462 AGGTGAGGAGGAAGGGCAGGAGG - Intergenic
938029621 2:127981386-127981408 AGCTGAGTCGGGGGTGCAGGAGG - Intronic
938029641 2:127981466-127981488 AGCTGAGTCGGGGGTGCAGGAGG - Intronic
938029679 2:127981589-127981611 AGCTGAGTCGGGGGTGCAGGAGG - Intronic
938029691 2:127981630-127981652 AGCTGAGTCGGGGGTGCAGGAGG - Intronic
938029706 2:127981671-127981693 AGCTGAGTCGGGGGTGCAGGAGG - Intronic
938572073 2:132570130-132570152 AGCTGGGTGGGGAGGGCCAAGGG - Intronic
938816715 2:134912098-134912120 GGCTGAGAAGGGTGGGCGGAGGG - Intergenic
939720627 2:145645988-145646010 TGGTGACCAGGGAGGGCAGAAGG + Intergenic
939876147 2:147580592-147580614 AGCTGAGGAGGGAGAGCATTAGG - Intergenic
941301009 2:163801313-163801335 AGCTGAAAACGGAGTGCAGAGGG - Intergenic
941497932 2:166230449-166230471 AACATAGTAGGGAGGGCAGCAGG - Intronic
941604496 2:167580555-167580577 GGCTGGGTAGGGAGGACACAGGG - Intergenic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942685257 2:178523815-178523837 GGCTGAGGAGGGATGGAAGAGGG - Intergenic
942943102 2:181642986-181643008 AGCTGAGTAAGGCGAGCAAAGGG + Intronic
944224230 2:197334096-197334118 AGCTGAGTATGGAGTGCATTTGG + Intergenic
944656478 2:201881019-201881041 AGCTTAGGAGGGAGGGCCTAAGG + Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
946943726 2:224797727-224797749 TTCTCAGTAGGGAGGGAAGAAGG - Intronic
947406242 2:229780545-229780567 GACTGAGCAGGGTGGGCAGAGGG - Intronic
947436578 2:230078256-230078278 AGAAAGGTAGGGAGGGCAGAAGG - Intergenic
947572765 2:231249036-231249058 AGGTGAGTAGGGAGAGAAGAAGG + Intronic
948119937 2:235522520-235522542 AGCTGGGGAGGGAAGGAAGACGG + Intronic
948371770 2:237494194-237494216 AGCAGAGGACAGAGGGCAGAGGG + Intronic
948436366 2:237956542-237956564 AGCAGACTAGGGAGGGCTGATGG + Intergenic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
1168779028 20:473150-473172 AGCTGAGCAGGGAGCACACATGG - Intergenic
1170391059 20:15874949-15874971 AGCAGAAGAGGGAAGGCAGAAGG + Intronic
1170551662 20:17482089-17482111 AGCTGGGGAGGGAGGGCGGTGGG - Exonic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171147126 20:22794736-22794758 AGCTGATTATGGAGGGAAAAGGG + Intergenic
1171237528 20:23539531-23539553 AGCTGCCCAGGGAGGTCAGAGGG + Intergenic
1171769598 20:29312215-29312237 GGCTGAGGAGGGAGGAAAGAAGG + Intergenic
1172113889 20:32562767-32562789 AGCAGAATGGGGAGGGCCGAGGG - Intronic
1172180610 20:33001191-33001213 AGGTGAGCAGGGAAGGCAGGGGG - Exonic
1172332569 20:34085608-34085630 AGCCGAGTAGGAAGAGCAGCAGG - Intronic
1172621381 20:36320311-36320333 AGCAGAGGAGGGAGGGGACACGG - Intronic
1172698340 20:36837230-36837252 GGCTGAGTTCTGAGGGCAGAGGG + Intronic
1173223909 20:41150658-41150680 GGATGAGAAGGGAGGGAAGATGG - Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173869349 20:46331810-46331832 GGCAGAGGAGGGAGGGCAGCTGG + Intergenic
1173927851 20:46794011-46794033 AGCAAAGTAGGGTGGGGAGATGG - Intergenic
1174559032 20:51416837-51416859 AGCTGAGCATGGGGGCCAGAGGG + Intronic
1174673014 20:52325251-52325273 TGGGGAGTAGGGAGGGCAGGTGG + Intergenic
1174819106 20:53712143-53712165 AGGGAAGTAGGGAGGGAAGAAGG - Intergenic
1175368392 20:58470802-58470824 AGTGGGGTTGGGAGGGCAGATGG - Intronic
1175405306 20:58722251-58722273 AGCCGAGCTGAGAGGGCAGAGGG - Intergenic
1176731105 21:10498239-10498261 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1177374999 21:20258555-20258577 TCCTGAGCAGGGAGGGCACAAGG + Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178180290 21:30152496-30152518 AGAAGAGTGGGGATGGCAGAGGG + Intergenic
1178610845 21:34078156-34078178 AGCTGTTTAGGGAGGGCCCATGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178918621 21:36723684-36723706 ACCAGAGGAGGGACGGCAGAAGG + Intronic
1179252690 21:39686012-39686034 AGCTGAGCAGGAAGGGCTGCTGG - Intergenic
1179273072 21:39866421-39866443 AGCTGAGGAGAGAGGGTTGATGG + Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179464562 21:41563003-41563025 AGCTTAGGAGAGAGGGTAGATGG - Intergenic
1180104255 21:45607578-45607600 AGGGGAGGAGGGAGGGGAGAAGG + Intergenic
1180135570 21:45859827-45859849 AGCTGAGGAAGCAGGGCAGGCGG + Intronic
1180729380 22:17970186-17970208 TGGTGAGAAGGGAGGACAGATGG + Intronic
1181338442 22:22159375-22159397 AGCTGATCACAGAGGGCAGATGG + Intergenic
1182508196 22:30800478-30800500 AGCTGGGCTGGGAGGGCGGACGG + Intronic
1182585180 22:31340919-31340941 ATCTGAGTGGGAAGGGCAGAGGG + Intronic
1182837645 22:33357290-33357312 AGCTAAATAGTGAGGGCACATGG + Intronic
1182910886 22:33983274-33983296 AGCTGAAAAGGGAGGTCAGCTGG + Intergenic
1183034331 22:35129671-35129693 AGCTGGGAAGGGAGAGGAGAAGG + Intergenic
1183532229 22:38364684-38364706 ACTTGAGTGGGGAGGGCAGGAGG + Intronic
1184391953 22:44207790-44207812 AGCTGAGAAGGGCAGGCAGATGG - Exonic
1184666692 22:45992992-45993014 GGCTGAGATGGGAAGGCAGAAGG - Intergenic
1185224288 22:49644126-49644148 AGCTGAGCTGGGTGGGCAGAGGG - Intronic
949413367 3:3789282-3789304 AACTGAGGAGGAAGGCCAGATGG + Intronic
949522691 3:4871111-4871133 AACAGAGTAGGAAGGGCATAGGG + Intronic
950010321 3:9718332-9718354 AGCAGAGCAGGGAGGGGAGCAGG + Intronic
950519855 3:13491645-13491667 AGCTGAGTAGATGGGGCAGTAGG + Intronic
950703860 3:14768170-14768192 AGGGGAGTGGGGAGGGCACAGGG + Intronic
950704124 3:14769560-14769582 AGGGGAGTGGGGAGGGCACAGGG + Intronic
952318610 3:32254920-32254942 AGCTGACTAGGGATGGTGGAGGG - Intronic
952817878 3:37461294-37461316 AGCTGAGTAAGGCAGGCTGAGGG - Intronic
954711229 3:52506025-52506047 AGATGAGAAGGGAAGGGAGATGG - Intronic
954927672 3:54251118-54251140 AGATAAGTAGGGAGGTCAGGAGG + Intronic
955467965 3:59255926-59255948 AACTAATTAGGGAGGTCAGAAGG + Intergenic
955945219 3:64187394-64187416 AGTTGGGAAGGGAGGGAAGAAGG - Intronic
956050968 3:65248224-65248246 AGCTGAGAAAAGGGGGCAGATGG + Intergenic
956621006 3:71221501-71221523 AGGAAAGAAGGGAGGGCAGAAGG - Intronic
956637306 3:71379078-71379100 AGATCAGTAATGAGGGCAGAGGG - Intronic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
960043086 3:113170088-113170110 AGCAGAGGAGGGAGGACAGTGGG - Intergenic
961181949 3:124884784-124884806 AGCTGAGTCGGTAGGACAAAGGG + Intronic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
962364205 3:134766739-134766761 AGAGGAGAGGGGAGGGCAGATGG + Intronic
962459025 3:135591698-135591720 AGCTGAGTTGGGAGGGGAGCAGG - Intergenic
962919291 3:139936066-139936088 AGCGGAGTAGGAAAGGCAGCGGG - Intronic
962935346 3:140075587-140075609 ACCTGAGCAGGGATGGCATAAGG - Intronic
963266165 3:143242200-143242222 AGCTGAGACAGGTGGGCAGAAGG - Intergenic
964769836 3:160212609-160212631 AGCAGAGCAGGAAGGGGAGAAGG - Intergenic
964790863 3:160452517-160452539 AGCTGAGCAGCTACGGCAGAAGG + Intronic
964826625 3:160835491-160835513 AGCTGAATAGGGAGGAAACAAGG - Intronic
966286137 3:178297455-178297477 AGCTGAGTAGGACTGGCAAAGGG + Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
967047740 3:185753296-185753318 GGCTGAGTAGAGGGGGCAGAAGG - Intronic
967120751 3:186380690-186380712 AGATGAGTAGGGTGAGGAGAAGG + Intergenic
968481605 4:835446-835468 AGCTGGGTGCGGAGGGCACAAGG + Intergenic
969669170 4:8580334-8580356 AGCTGTGCAGGCGGGGCAGAGGG - Intronic
970021607 4:11575411-11575433 AGGTGAGGAGGAAGAGCAGAGGG + Intergenic
970176966 4:13349248-13349270 AGCTGTGGTGGGAGGGGAGAGGG + Intergenic
972142107 4:35973465-35973487 AGCTGAGAAGGAAGAACAGAAGG + Intronic
973938649 4:55879537-55879559 TGCAGGGTAGGGAGGGGAGATGG + Intronic
975115030 4:70670796-70670818 AGAAGACTAGGGAGGGAAGAGGG + Intronic
975745003 4:77466715-77466737 AGCTGAGGAGTGCAGGCAGATGG + Intergenic
975775231 4:77779286-77779308 AGATGAGTAGGAAGGGAGGAAGG - Intronic
977557134 4:98497750-98497772 AGCTGAGTCTAGAGGGGAGACGG + Intronic
978529380 4:109698885-109698907 AGTTGAGAATGGAGAGCAGAGGG - Intronic
978666822 4:111194113-111194135 TGATGAGTAGGTAGGGCACAGGG + Intergenic
979873377 4:125855040-125855062 AGCTGACTAGCGAAGGAAGAAGG + Intergenic
980588268 4:134849160-134849182 AGCTGAGTGGTGGGAGCAGATGG + Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
981800650 4:148651913-148651935 AGATTAGTAGGGAATGCAGATGG + Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984081251 4:175252516-175252538 AGGTGAATGGGGAGGCCAGAAGG - Intergenic
986039865 5:3983027-3983049 AGCTGAGTAGGGATAATAGATGG - Intergenic
986365212 5:7022253-7022275 ACCTGAGCTGGGAGGGGAGAGGG + Intergenic
986693835 5:10334639-10334661 AGAGGAGAAGTGAGGGCAGAAGG + Intergenic
987017171 5:13832486-13832508 AGCAGAGAAGGGAGGCAAGAAGG - Intronic
988347013 5:30050290-30050312 AGCTGAGTAGGAATGACAGCAGG - Intergenic
988635006 5:32973705-32973727 AACTGAGTGGGGAGGGGAAATGG - Intergenic
990018866 5:51100965-51100987 AGCTGAGTTGGGTGTGCAGGAGG - Intergenic
992527919 5:77630007-77630029 AGCTGGGTGGGAAGGGAAGAGGG + Exonic
995435391 5:112129266-112129288 ACCTGAGGAGGGTGGACAGAAGG - Intergenic
995762296 5:115576313-115576335 ATTTGATTATGGAGGGCAGAGGG - Intergenic
995786965 5:115841078-115841100 AGCTGAGTGGGGCGGGGGGAGGG - Intronic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996805229 5:127447097-127447119 TGCTGAGTAGGCTGGGCAGGAGG + Intronic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997585975 5:135043746-135043768 AGATGAGAAGGCAGGGCATAGGG + Intronic
998142373 5:139707421-139707443 AGCTGAGCAGGGCAGGTAGAGGG - Intergenic
998385748 5:141756267-141756289 TGCTGGGGAGGGAGAGCAGAGGG + Intergenic
998393282 5:141801647-141801669 GACTGAAGAGGGAGGGCAGAGGG - Intergenic
999233473 5:150076803-150076825 AGGTGAGTTGGCCGGGCAGAAGG - Intronic
999809630 5:155115167-155115189 AGCTGAGGAGTGCGGGCACACGG + Intergenic
1001131974 5:169071842-169071864 GGATGAGTGGGCAGGGCAGAGGG + Intronic
1001661612 5:173397349-173397371 AGCTGAAGAGGGAGGGGACAGGG + Intergenic
1002453518 5:179332682-179332704 TGCAGAGAGGGGAGGGCAGAGGG + Intronic
1002535919 5:179875285-179875307 AGCTGTGCAGTGAGGGCTGAGGG + Intronic
1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG + Intergenic
1002824881 6:763671-763693 AGCTGAGGACCGAGGGCATAAGG + Intergenic
1002898474 6:1392533-1392555 AGGGGAGCAGGGAGGGCAGCTGG - Intronic
1002969365 6:1997893-1997915 AGCTGAGTAGGCAGGGGAAACGG + Intronic
1004099876 6:12598317-12598339 AGCTGAGTAGTGACAGTAGATGG - Intergenic
1004505868 6:16246257-16246279 AGCTGGGTGGGGAGGTCAGGGGG - Intronic
1004653077 6:17630742-17630764 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1006442018 6:34058906-34058928 AGCCGAGGAGGGATGGCAGGAGG + Intronic
1006602571 6:35235728-35235750 AGCAGAAGAGGAAGGGCAGAAGG - Intronic
1006620758 6:35362416-35362438 TGGTGAGTAGGCAGAGCAGATGG - Intronic
1006731015 6:36236151-36236173 AGGTGAATGGGGAGGCCAGAAGG - Intergenic
1007077017 6:39074525-39074547 GGCAGATTAGGGAGGACAGAGGG - Intronic
1007501698 6:42303421-42303443 AGCAAAGTAGGGAGGGCAGCAGG + Intronic
1007665463 6:43510536-43510558 GGCTGAGTGGGTAGGGCTGACGG + Exonic
1007925544 6:45646770-45646792 AGCTGAGGGTAGAGGGCAGAGGG + Intronic
1008362335 6:50635541-50635563 AGGGGAGAAGGGAGGGGAGAAGG + Intergenic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009651488 6:66481774-66481796 AGCTGAGGACCGAGGGCAGTGGG - Intergenic
1011477621 6:87763524-87763546 AGGTGAGTAGGTAGGAGAGATGG + Intergenic
1012034047 6:94108941-94108963 AGCTGAGTAAAGAGAGCATATGG - Intergenic
1013582795 6:111552641-111552663 AGCTGGGGAGAGAGGGGAGAGGG - Intergenic
1013751948 6:113417360-113417382 AGATGATTAGGGAAGGCAAAGGG + Intergenic
1015696425 6:135985271-135985293 AGCTCAGCTGTGAGGGCAGATGG - Intronic
1016021006 6:139236053-139236075 AGGTGAATGGGGAGGCCAGAAGG - Intergenic
1016464959 6:144316024-144316046 AGATGAGAAGGTAGTGCAGAAGG - Intronic
1017619556 6:156281810-156281832 AGGTGAATAGGAAGGGCACATGG - Intergenic
1017713131 6:157187493-157187515 AGCGAAGTAGGGTGGGGAGAAGG - Intronic
1018662819 6:166104222-166104244 AGCTGAGAAGCGAGTGAAGAAGG - Intergenic
1018914374 6:168123819-168123841 GGCTGATTCGGGAGGTCAGAGGG + Intergenic
1019194505 6:170273306-170273328 AGCTGAGCTGTGGGGGCAGAGGG - Intergenic
1019521649 7:1463407-1463429 AGGGGAGGAGGGAGGGGAGAAGG + Intergenic
1019920622 7:4161117-4161139 AGCAGAGGAGGCAGGGAAGAGGG + Intronic
1020227020 7:6288444-6288466 AGGGGAGGAGGGAGGGAAGAAGG - Intergenic
1020372662 7:7451046-7451068 AGGAGAGAAGGGAGGGCAGTGGG + Intronic
1020666272 7:11047799-11047821 AGAAGAGGAGGGAGGGCAGGAGG + Intronic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1022633000 7:32103214-32103236 AGCAGAAAAGGGAGGGGAGAAGG + Intronic
1022667193 7:32422483-32422505 AGCTGAGGGGGGAGGCCAGGTGG - Intergenic
1023170486 7:37386258-37386280 AGCTGGGGAGGGAGGGCTGGAGG + Intronic
1023921780 7:44635528-44635550 GGTGGAGTAGGGAGGGCAGCTGG + Intronic
1024252184 7:47514537-47514559 AGCTGAGAAAGGAGACCAGAGGG - Intronic
1024556846 7:50611111-50611133 TGCTTAGTAGGGAGAGGAGATGG - Intronic
1025255026 7:57378966-57378988 AGGAGAGTAGGGAAGGGAGAAGG + Intergenic
1025638906 7:63349471-63349493 AGCTGTGCAGGGAGGTCAGGAGG + Intergenic
1025643793 7:63398621-63398643 AGCTGTGCAGGGAGGTCAGGAGG - Intergenic
1025875297 7:65476042-65476064 AGCTGAGTTGGGTGTGCAGGAGG - Intergenic
1026852681 7:73734993-73735015 TGCTGGGAAGGGAGGGCAAAGGG + Intergenic
1027931794 7:84546527-84546549 AGCTGAATGGGGAGGACAGCAGG + Intergenic
1029457185 7:100677320-100677342 AACGGTGTAGGGAGAGCAGAAGG - Intronic
1029643498 7:101836481-101836503 TGCTGAGCAAGGAGGGCAGGTGG - Intronic
1030043986 7:105478095-105478117 TGCTAAGTAGGCAGGGCACAGGG - Intronic
1030319669 7:108152176-108152198 AGCTGAGTAAAGACTGCAGAAGG + Intronic
1030498415 7:110328967-110328989 AGCTGAGGAGGAATGGTAGATGG + Intergenic
1030524851 7:110640579-110640601 AGTTGAGTAGGCATGGCACAGGG + Intergenic
1030659326 7:112204058-112204080 TGCAGAGTAGGGGAGGCAGAAGG - Intronic
1031056470 7:116997985-116998007 TGCTGAGGAGCGAGGGCACACGG - Intronic
1032464881 7:132137868-132137890 AGGAGAGAAGGGAGGGCAGGTGG + Intronic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1033354918 7:140591939-140591961 AGGGGAGTAGGGAGGGGGGAGGG - Intronic
1033405937 7:141072024-141072046 TGCCGAGGAGGGAGGGCAGGTGG + Intergenic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1034451341 7:151138725-151138747 GGCTGAGTAGGGAGGTCGGACGG + Intronic
1034598475 7:152223281-152223303 AATTACGTAGGGAGGGCAGAAGG + Intronic
1034989449 7:155538798-155538820 AGTTGAGTGGGGTGGGCAGGAGG - Intergenic
1035054385 7:156024342-156024364 AGCTGACAAGGGCGGGCAGCTGG - Intergenic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035768451 8:2127263-2127285 ACCTGACTGGGGAGGGGAGATGG + Intronic
1035929140 8:3762210-3762232 ATCTGAGTCAGGAGGGCACATGG - Intronic
1036424228 8:8628494-8628516 GGCTCACCAGGGAGGGCAGAAGG - Intergenic
1036801429 8:11795135-11795157 AGCTGAGGAGTGCGGGCGGATGG + Intergenic
1037586552 8:20280672-20280694 AGCAGAGCAGGGAGGGAGGAAGG + Intronic
1038001112 8:23391960-23391982 AGCTAAGCAGGAAGGGCATAGGG - Intronic
1040495463 8:47961258-47961280 AGCTGCGGCGAGAGGGCAGACGG - Intronic
1041301083 8:56412022-56412044 AGCTGAGTAATGAGAGCACATGG - Intergenic
1041713991 8:60917005-60917027 AGCTAAGAAGGGAGGGTTGAGGG + Intergenic
1042658766 8:71131240-71131262 AGCTGGAGAGGTAGGGCAGAGGG - Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043844977 8:85152988-85153010 GGCTGAGGAGTGCGGGCAGATGG + Intergenic
1045507447 8:102788813-102788835 AGGTGAACAGGGAGGGAAGAGGG - Intergenic
1046320189 8:112564326-112564348 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1046659542 8:116934309-116934331 AACTGGGTAGGGTTGGCAGAAGG + Intergenic
1046694255 8:117320877-117320899 ACCTGAGTGGGGAGGGTAGAAGG + Intergenic
1048132077 8:131708840-131708862 AGGGGAGTAGGGAAGGGAGAGGG + Intergenic
1048222264 8:132552759-132552781 GACTGAGGCGGGAGGGCAGAGGG + Intergenic
1048251236 8:132868467-132868489 AGAAGAGAAGGGAGGGCAGTGGG - Intronic
1048575976 8:135690446-135690468 GGCTGAGGAGTGAGGGCACACGG - Intergenic
1049037143 8:140085654-140085676 AAGTGAGTAGGCAGAGCAGAAGG - Intronic
1049054100 8:140221438-140221460 AGGTGAGTTGGTATGGCAGACGG - Exonic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049222507 8:141434417-141434439 TGCTGGGTAGGGGGGGCAGGAGG + Intergenic
1049288267 8:141788278-141788300 AGCTGAGCAGGGAAGGAAGGAGG - Intergenic
1049494718 8:142924319-142924341 AGCTGAGAGGGGCAGGCAGAGGG + Intergenic
1049526842 8:143131185-143131207 TCCTGAGTAGGGACAGCAGAGGG + Intergenic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051318808 9:15876917-15876939 AGCTGAGTAAGTTGGGCAAATGG - Intronic
1052041238 9:23741491-23741513 AGTTGAGAGGGGAGGGAAGAAGG - Intronic
1052727083 9:32242041-32242063 AGGAGAGGAGGGAGGGCAGTGGG + Intergenic
1052932360 9:34066262-34066284 AGCACACTAGGGAGGGAAGAAGG + Intergenic
1052951832 9:34219759-34219781 AGAGGAGAAGGGAGGGGAGAGGG - Intronic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1053206244 9:36188841-36188863 AGCTGAGTGGGGAGCGTTGATGG - Intergenic
1053341295 9:37336479-37336501 AGCAGAGTTGGGATGGCAGGTGG + Intronic
1054972905 9:71109184-71109206 AGCTGATGAGGGAGGCCAGCAGG - Intronic
1055883417 9:81030832-81030854 AGCTGATCAGAGAGGTCAGAGGG - Intergenic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1056759239 9:89403375-89403397 ACCAGAGTTGGGTGGGCAGAGGG - Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1059435049 9:114270962-114270984 ACCTGAGCAGGTAGTGCAGAGGG - Intronic
1059517017 9:114905500-114905522 AGCTGAATAAGGAGGGGTGAGGG + Intronic
1059693664 9:116710249-116710271 AGCTTTCTAGGGAGAGCAGAGGG - Intronic
1059770548 9:117419840-117419862 AGCTGAGAAGGGAGGATGGAAGG - Intergenic
1059803498 9:117774032-117774054 AGGGGAGAAGGGAGGGGAGAAGG - Intergenic
1059962113 9:119575719-119575741 AGATAAGTAGGGAAGGCAGAGGG + Intergenic
1060936150 9:127517347-127517369 AGCTCAGGAGAGAGGGCAGCAGG - Intronic
1061119179 9:128632764-128632786 GCCTGAGCAGGGAGGGCAGGTGG - Intronic
1061404411 9:130385498-130385520 GGCTGAGTGGGGAGGGCGCAGGG + Intronic
1062121889 9:134838345-134838367 AGGTGTGAAGGGAGCGCAGAGGG + Intronic
1185505173 X:627852-627874 AGCTGAGCTGGGAGGACGGAGGG + Intronic
1186077121 X:5892771-5892793 TGCTGAGCGGGTAGGGCAGAGGG + Exonic
1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG + Intergenic
1187936482 X:24341187-24341209 AGGTGAGTGGGCAGGGAAGATGG + Intergenic
1189422822 X:40871698-40871720 AGCACAGTAGGGAGGAGAGAAGG + Intergenic
1189730843 X:44019103-44019125 ACCTGAGTAGGCAGGGGAGCTGG - Intergenic
1189844259 X:45118019-45118041 AGTTGAATTGGGAGGGAAGAGGG - Intergenic
1190233128 X:48597645-48597667 ATCTGAGAAGGGAAGGCGGAGGG + Intronic
1190766671 X:53480965-53480987 AGGTGGATAGGGAGGCCAGAAGG - Intergenic
1192142935 X:68660577-68660599 AGCTGAGTAGAGATGGAGGATGG - Intronic
1194227996 X:91285584-91285606 TGCTAAGTAGAGATGGCAGAAGG - Intergenic
1194828786 X:98595866-98595888 AGATGAGTAGGGGTGGGAGATGG - Intergenic
1194859564 X:98980039-98980061 AGCTGGATGGGGAGGCCAGAAGG - Intergenic
1195244465 X:102983070-102983092 AGCTGAGCAGGCAGGGCTGAAGG + Intergenic
1196237554 X:113299998-113300020 AGGGGAGAAGGGAGGGGAGACGG - Intergenic
1196738355 X:119000889-119000911 AGGAGAGGAGGGAGGGGAGAAGG - Intronic
1197026469 X:121755964-121755986 AGCAGAGCCGGGGGGGCAGAAGG - Intergenic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198385366 X:136124044-136124066 AGCTGAGGTGGGAGTGCAGCAGG + Intergenic
1198923989 X:141766379-141766401 AGCTGAGTATGGGTGTCAGAGGG + Intergenic
1200062122 X:153488339-153488361 AGCAGAGGAGGAAGGGCACAGGG + Intronic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic
1200287476 X:154837547-154837569 AGCTGAGGAGGGAGAGGTGACGG + Exonic