ID: 1078068410

View in Genome Browser
Species Human (GRCh38)
Location 11:8093020-8093042
Sequence GGTCCCAAGTGAGCACAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078068410 Original CRISPR GGTCCCAAGTGAGCACAAAT GGG Intronic
903379362 1:22886098-22886120 GGTCCCAGGAGGGCACCAATAGG + Intronic
915248933 1:154575017-154575039 GGTCCCAGATGTGAACAAATCGG - Intronic
915337390 1:155153170-155153192 GGTTGCAAGTGAGCAGAGATTGG + Intergenic
916270984 1:162941155-162941177 GGTCTCTGGTGAGCACAATTAGG + Intergenic
919598102 1:199589712-199589734 GGTGCTAAGGGAGCACAAAGGGG - Intergenic
920815078 1:209323691-209323713 GGTCCTAAGTGATTACAAAATGG - Intergenic
922391280 1:225146005-225146027 CGTACTAAGTGAGCACAAATTGG - Intronic
922635527 1:227166741-227166763 CGCCCCTAGTGAGCACTAATGGG - Intronic
1072918927 10:99559087-99559109 CTTCCTAAGGGAGCACAAATAGG - Intergenic
1078068410 11:8093020-8093042 GGTCCCAAGTGAGCACAAATGGG + Intronic
1081358393 11:42142500-42142522 TAACCCAAGTCAGCACAAATAGG - Intergenic
1088655575 11:111996154-111996176 AGTCCCTACTGAGCAAAAATGGG - Intronic
1090923474 11:131229471-131229493 GGTTCCAAGAGAGCACACAGAGG + Intergenic
1096487174 12:51991275-51991297 GCTCCCAACTGAGCAAAGATGGG - Intronic
1099439096 12:82679955-82679977 GTCCCAAACTGAGCACAAATGGG - Intergenic
1102427075 12:112852234-112852256 GATCCCAAGGGAGCAAAGATAGG + Intronic
1107598676 13:41990532-41990554 GCTCCCCAGAGAGCACACATAGG - Intergenic
1111877202 13:93912416-93912438 TGTACCAAGTTATCACAAATTGG + Intronic
1113308649 13:109107214-109107236 GTTCACAAGTAAACACAAATAGG - Intronic
1114344190 14:21778527-21778549 GTTCCCAAGGGAGCACCAAGTGG + Intergenic
1122036027 14:98949990-98950012 GTTCCCCAGTGAGCACACAGAGG - Intergenic
1123141439 14:106082862-106082884 GGTTCCAAGTGAGGAAACATAGG - Intergenic
1123166613 14:106331087-106331109 GGTTCCAAGTGAGGAAACATCGG - Intergenic
1123169298 14:106356126-106356148 GGTCCCAAGTGAGGAAATATCGG - Intergenic
1123199867 14:106652204-106652226 GGTTCCAAGTGAGGAAACATCGG - Intergenic
1137383864 16:48023554-48023576 GTTCCCAAATGACCACAATTTGG - Intergenic
1141884529 16:86882577-86882599 TGTCCCAAGTGGGCACAGGTGGG + Intergenic
1146970569 17:37068422-37068444 GGTCCCGTGTGAGGACAGATAGG + Intergenic
1151549944 17:74816589-74816611 GGACCCAGGAGAGTACAAATGGG - Intronic
1153996815 18:10449962-10449984 GCCCCCAAGGGAGCAAAAATTGG - Intergenic
1158710615 18:59834325-59834347 GGTGACTAGTGAGCACAGATTGG - Intergenic
1161821370 19:6533035-6533057 GGTCCCAGGTGGGCCCAGATGGG - Intronic
1162215762 19:9132581-9132603 GGTCAGACGTGAGCACAAAGGGG + Intergenic
1164396615 19:27869833-27869855 GGTCCCAAATGGGAATAAATGGG + Intergenic
925948565 2:8889848-8889870 GGGCCCAAGTGGGCACAAGAAGG - Intronic
929796944 2:45067167-45067189 GGTCCCAAGGTCACACAAATAGG - Intergenic
932202125 2:69839083-69839105 AGTCCCAAGTCAGCAAAAACAGG - Intronic
938953176 2:136275993-136276015 TGTCCCAAGTGAGGCCAAAGTGG - Intergenic
941968712 2:171326753-171326775 GGTACTAAGGGAGTACAAATGGG - Intronic
942923417 2:181404684-181404706 GGTCCCATGTGAACTGAAATTGG + Intergenic
946844238 2:223845097-223845119 GGTCACAAGTGAACCCAAATTGG - Intergenic
948605829 2:239134230-239134252 CGTCACAGGTGAGCACAAATGGG - Exonic
1171235126 20:23518585-23518607 TGTCCCAAGTGAGCAGAATCAGG + Intergenic
1171329685 20:24326433-24326455 GGGCTCAAGTGAGCTAAAATGGG + Intergenic
1174897256 20:54462786-54462808 GGTCTGAATTGAGCAGAAATTGG + Intergenic
1175103211 20:56594991-56595013 GACCCCAGCTGAGCACAAATGGG - Intergenic
956246756 3:67192128-67192150 ATTCCCAAGAGAGCAAAAATTGG - Intergenic
962602964 3:137009202-137009224 GGTACCATCTGGGCACAAATAGG - Intronic
971252443 4:24984793-24984815 GGGCCCATGTGAGGACAAATTGG + Intergenic
982509949 4:156269576-156269598 AGTTCCAAGTGAGAACAAAGAGG - Intergenic
984859278 4:184221833-184221855 GGTCCCAAGTCAGCCCATGTCGG + Intergenic
988267057 5:28965789-28965811 GGTCCTGAGTGAGCAAAAAAGGG - Intergenic
990180422 5:53154746-53154768 TGTACCAAATGAGCACAAAGTGG - Intergenic
991515919 5:67435261-67435283 GGTCCCAAGTGAACTGAAACTGG + Intergenic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
994994883 5:107048192-107048214 ACTCCCAAGTCAGCACAACTTGG - Intergenic
997209881 5:132070986-132071008 GTGCCCAAGTCAGCACAAACAGG - Intergenic
999115554 5:149160555-149160577 AGTCCCAAATCAGCACAAGTAGG - Intronic
999738684 5:154532582-154532604 GGTCCCATGTTAACACAAAATGG - Intergenic
1007528368 6:42517369-42517391 AATCCAAAGTAAGCACAAATTGG + Intergenic
1009569216 6:65360478-65360500 GGTCCCCAGAGAGCCAAAATAGG - Intronic
1010374613 6:75152332-75152354 GGCCCCAAAAGAGTACAAATTGG - Exonic
1012209516 6:96502481-96502503 GGTGCCAAGGGAACAAAAATTGG + Intergenic
1015226811 6:130866545-130866567 GATCCCACATAAGCACAAATAGG - Intronic
1017310645 6:152973112-152973134 TGTCTAAAGTGAGCACAACTTGG - Exonic
1017480722 6:154851763-154851785 GGTCCTAAGTGAGCTCATGTGGG - Intronic
1020140768 7:5610507-5610529 GGTCCCAAGGGAGCCGAAATGGG - Intergenic
1020346140 7:7165696-7165718 GGTACCATGTGATCATAAATTGG - Intronic
1020671560 7:11121760-11121782 TGTCCCAAGTGGGAACAAGTGGG + Intronic
1022889062 7:34677216-34677238 GGTCCCCAGTGGGCAGAAAATGG - Intronic
1024157316 7:46638683-46638705 GGTGCTAAGTGAGCAAGAATTGG - Intergenic
1036785156 8:11680861-11680883 GGTCGCAACTGAGAAGAAATGGG - Intronic
1044648325 8:94468278-94468300 GGTGCCAAGCGAGGAAAAATGGG - Intronic
1045739691 8:105342416-105342438 GGGCACAACTGAGCACAAACTGG + Intronic
1045846883 8:106647398-106647420 TGTCCCAAATGACCACAAAGAGG - Intronic
1047177160 8:122552939-122552961 GCTGGCAAGTGAGGACAAATTGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1052771912 9:32697768-32697790 GCTGCCAAGTGTGCAGAAATGGG - Intergenic
1061108646 9:128551992-128552014 GGTCCCAAGTCAGCCTAATTCGG - Intergenic
1185432067 X:17276-17298 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185441383 X:229990-230012 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1189831914 X:44983237-44983259 CCCCCCAAGTCAGCACAAATAGG + Intronic
1190496657 X:51033461-51033483 GGCCTCAAGTGAGCAGAAAGAGG - Intergenic
1191736706 X:64395277-64395299 GCTCCCAGGTGAGCACCAAGAGG + Intronic
1195018683 X:100803748-100803770 GCTCCAAAATGAGCAGAAATAGG + Intergenic
1195704326 X:107728017-107728039 GGTCTCAAGTGAGCACTGATTGG + Intronic
1197328803 X:125127808-125127830 TGTCCATATTGAGCACAAATTGG - Intergenic
1199612330 X:149629163-149629185 AGTGCCAAGTGAGGATAAATAGG + Intronic