ID: 1078071281

View in Genome Browser
Species Human (GRCh38)
Location 11:8113199-8113221
Sequence TCTTTTAAGCATTCAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078071281_1078071283 -9 Left 1078071281 11:8113199-8113221 CCAGCCACTGAATGCTTAAAAGA 0: 1
1: 0
2: 3
3: 16
4: 178
Right 1078071283 11:8113213-8113235 CTTAAAAGAAGTCCATTTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078071281 Original CRISPR TCTTTTAAGCATTCAGTGGC TGG (reversed) Intronic
904063796 1:27732116-27732138 TCTTTTAATTATTATGTGGCTGG - Intronic
906389077 1:45398207-45398229 TATTTTAAGAATTCAGTGACAGG - Intronic
906471548 1:46134779-46134801 ACTTTTCAGCATTTAGTGGTGGG + Intronic
909564548 1:77039941-77039963 TCCCTTAAGCATTCAGATGCTGG - Intronic
910011918 1:82474968-82474990 TGTTTTAAGCACTCAGTCTCTGG - Intergenic
914417863 1:147501020-147501042 AGTTCTAAGCATTCAGTAGCTGG - Intergenic
917362514 1:174192616-174192638 TCTGTTAAGAAATCAGAGGCTGG - Intronic
919463955 1:197910297-197910319 TCTTTTATGCCTGCAGTGTCAGG - Intergenic
922353116 1:224751197-224751219 TCTTTTAAGCCTCCAGTGAGAGG + Intergenic
922451439 1:225740848-225740870 TCTTTTCTTCATCCAGTGGCAGG + Intergenic
923086936 1:230709270-230709292 TGCTTTAAGCAATCTGTGGCTGG + Intronic
923821560 1:237448878-237448900 TCTTTTAAGCAATAAGTAGTTGG + Intronic
1063131381 10:3180580-3180602 TCTTTGAAGCTGGCAGTGGCTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065089932 10:22221328-22221350 TCTTTTAAGCCTTCAGTAATGGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1067764813 10:49076796-49076818 TCTTATGAGCGTTCACTGGCAGG - Intronic
1068611396 10:59064279-59064301 TGTTTTCAGCACTCAGTAGCTGG + Intergenic
1072133234 10:92517251-92517273 TCTGTTAAGCATTCTGGGACAGG - Intronic
1072552142 10:96487219-96487241 TCTGTTAAGCAGCCAGTGCCAGG + Intronic
1072897991 10:99383570-99383592 TTTTTTAAGCACTAATTGGCTGG + Intronic
1074110889 10:110422162-110422184 TCTTTTAAGAAGTGAGTGCCAGG + Intergenic
1074199573 10:111222878-111222900 GCTTAGCAGCATTCAGTGGCAGG - Intergenic
1074990633 10:118703086-118703108 TGTGTTAAGAATTCAGTGGCTGG - Intronic
1076289165 10:129331156-129331178 TCTTCTGATCATACAGTGGCAGG - Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1081383614 11:42445492-42445514 AGTTTTAACCATTCAGTGGAGGG - Intergenic
1083928958 11:65828418-65828440 TGTTTTAAGCCATCAGTTGCTGG - Intronic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1084284643 11:68123022-68123044 CCTTTCAAACATCCAGTGGCCGG - Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1088629727 11:111763164-111763186 TCTTTCAAGCTTTCTGTGGCTGG - Intronic
1091158939 11:133401805-133401827 TCTTTTAAGCTTTCAGTGAGTGG + Intronic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1097145473 12:56936646-56936668 TCTTTGTAGCACTCAGTGACCGG - Intergenic
1097713090 12:62935684-62935706 TCTCTTAAGAAATCAGAGGCTGG + Intergenic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1098580915 12:72097870-72097892 TCTTTTAAGCATTTGGTAACAGG - Intronic
1100865680 12:98854218-98854240 TGTTTGAACCATTCAGTGGGTGG + Intronic
1101914370 12:108884907-108884929 CCTTCTAAGCCTTCAGTGGATGG + Intronic
1103860863 12:124012611-124012633 TCTTTGATGCATGCAGAGGCTGG - Exonic
1104520897 12:129474018-129474040 GCTTTTAAACATGCAGTGACTGG + Intronic
1106986654 13:35360324-35360346 TCTTTCATGCCTTCAGTGGGTGG - Intronic
1107357022 13:39578441-39578463 TATTTTAAGCATTCAGTCATTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107531053 13:41282671-41282693 GCTTTCAAGCAATGAGTGGCTGG + Intergenic
1108416682 13:50204730-50204752 TCATTTAAACACCCAGTGGCAGG + Intronic
1108777934 13:53788968-53788990 TTTTTATAGCATTCAGTGTCTGG - Intergenic
1108897963 13:55359086-55359108 TGTTTTAAGCATTTTCTGGCAGG + Intergenic
1110521312 13:76481527-76481549 TCTTTTAATTATTCAGTGAGAGG - Intergenic
1110924871 13:81138471-81138493 ACGTTTAAGCATACAGAGGCAGG + Intergenic
1111202926 13:84962448-84962470 ACTTTCAAGCCTGCAGTGGCAGG + Intergenic
1112599100 13:100837793-100837815 TCTATTAATCATTCAATGGTAGG + Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1115118122 14:29907441-29907463 TCATTCAATCATTCAGTGCCAGG + Intronic
1117762497 14:59045301-59045323 TCTTTTCAGCAATCAGTGTTGGG - Intergenic
1119020072 14:71102757-71102779 TCTTTTATCCATTAAATGGCAGG + Intronic
1122335864 14:100982399-100982421 TCCTTTAAGCATTCATTAGGTGG - Intergenic
1123045012 14:105507754-105507776 TCTTTTACAAATTGAGTGGCAGG + Intergenic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1126340189 15:47632440-47632462 TCCTTTCAGCTTTCAGTGGTTGG + Intronic
1128651305 15:69415542-69415564 TGTTTTGAGCATTCAATGACTGG + Intronic
1129918738 15:79299669-79299691 TATTTTTAGCATTCATTGCCAGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130303299 15:82696619-82696641 TCTTTGCAGCATTCACTGTCAGG + Intronic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131731569 15:95287382-95287404 TCTTTCAAGCATTTAGTCTCAGG + Intergenic
1136650553 16:31666148-31666170 ATTTGTAAGCATCCAGTGGCAGG - Intergenic
1139491867 16:67290472-67290494 ACTTTTAAGCATTCTTAGGCCGG - Intronic
1140061912 16:71577944-71577966 TCTCTTAACCCTTCAGTGGGTGG - Intergenic
1141532359 16:84655367-84655389 ACTTTTAAGAATTCAGAGCCTGG + Intronic
1144446820 17:15338810-15338832 TCTCTTAAGAATTGACTGGCTGG - Intronic
1145008627 17:19353268-19353290 TCTCTTAAGAAATTAGTGGCTGG - Intronic
1145855662 17:28154528-28154550 TATTGTAAACATCCAGTGGCAGG + Intronic
1150886599 17:69093568-69093590 ACTTTTAAGCATTTTGGGGCGGG - Intronic
1151082890 17:71348741-71348763 TCTTTGAGGCATTTAGTGGCTGG + Intergenic
1152092650 17:78255646-78255668 TGTTGTGAGCATTCAGTGACTGG + Intergenic
1153593109 18:6695584-6695606 AGTTTTAAGCATCCAGTGGGGGG - Intergenic
1155078117 18:22381047-22381069 TACTTGAAACATTCAGTGGCAGG + Intergenic
1155364766 18:25038948-25038970 CCTTCAAAGCCTTCAGTGGCTGG + Intergenic
1155742918 18:29312697-29312719 TGCTTGAAGCAGTCAGTGGCAGG + Intergenic
1156322263 18:36037960-36037982 TCTTAAAAGCATTCAGTTCCAGG + Intronic
1157754393 18:50205061-50205083 TCATTGCAGCATTCAGAGGCAGG - Intergenic
1158911166 18:62064150-62064172 TCACTTAAGCCTTCAGTGACAGG - Intronic
1159610483 18:70519776-70519798 TCTTTTAAGTTTTTGGTGGCTGG + Intergenic
1159861241 18:73651989-73652011 TTTAGAAAGCATTCAGTGGCGGG - Intergenic
1159973465 18:74681326-74681348 TCATTTAAGCATTTAGGCGCAGG - Intronic
1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG + Intergenic
1164899036 19:31902629-31902651 TATTTTAACCCTTCAGTGGAAGG - Intergenic
1165008440 19:32824970-32824992 TCTTGTTCGCGTTCAGTGGCAGG + Intronic
1166994699 19:46714531-46714553 TCCTTTGAGCATTGGGTGGCAGG - Intronic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
1168441263 19:56369155-56369177 TCTTTTAAGCACTGTGTGGTGGG + Intergenic
928703595 2:33923835-33923857 TTTTTTAAGTATTCAGTGTTTGG - Intergenic
929334994 2:40731980-40732002 TCTTTTAATTTTTCAGAGGCAGG + Intergenic
932387014 2:71344302-71344324 TATTTTCAGCATCCACTGGCAGG - Intronic
935720023 2:105971780-105971802 TCTTCTCGGCATTCAGTGTCAGG + Intergenic
942469292 2:176242952-176242974 GCTTCTACCCATTCAGTGGCCGG - Intergenic
944494404 2:200291797-200291819 ATTTTTAAGAATTAAGTGGCCGG + Intergenic
948728277 2:239947698-239947720 TCTTTGAGGCCTTCAGTGGATGG - Intronic
1170155830 20:13268616-13268638 TCTTTAAAACATGCAGTGACCGG - Intronic
1175198811 20:57264714-57264736 TATTTTAAGTATTTAGTGGTAGG - Intronic
1175249382 20:57599899-57599921 TTTTTTGAGCCTTCGGTGGCTGG + Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1179175517 21:39005168-39005190 GCTTTTATGCTTTCAGAGGCAGG + Intergenic
949624356 3:5850435-5850457 CCTATTAAGCGTTGAGTGGCTGG - Intergenic
950224907 3:11225504-11225526 TCTTTGGAGCACTCAGTGACGGG + Intronic
950980818 3:17302684-17302706 TCTTCTAGGGATTCAGTGGATGG - Intronic
951694477 3:25431439-25431461 TCTTATAAGCATTCAAAGTCAGG + Intronic
956266743 3:67404984-67405006 TTTTTTAAGAATTCAGTGTTAGG + Intronic
959936044 3:112030050-112030072 TCTTTTAAGTATACAGTTGTAGG + Intergenic
965108940 3:164396274-164396296 TCTTTTAAGTGTACATTGGCTGG + Intergenic
965726160 3:171718706-171718728 TCTTACAAGCAGTGAGTGGCAGG - Intronic
966394084 3:179483506-179483528 TCTTTTAAGCTTTTATTGCCAGG - Intergenic
967051790 3:185791743-185791765 TGCTATAAGCAGTCAGTGGCTGG - Intronic
968483942 4:849802-849824 TCTTATAAGCATGCGGGGGCGGG + Intronic
970511996 4:16790137-16790159 TCCTATAAGCACTCAGTGTCTGG - Intronic
970626162 4:17886068-17886090 TCTTCTGAAAATTCAGTGGCTGG - Exonic
971359692 4:25925542-25925564 GCTTTTAAGTATTTATTGGCAGG + Intronic
972157210 4:36179213-36179235 TATTTTAAGCCTTCATTGCCTGG - Intronic
972195631 4:36650295-36650317 TCCTTTTAGATTTCAGTGGCTGG + Intergenic
972954096 4:44367749-44367771 TATTTTATACATTCAGTAGCTGG - Intronic
973062842 4:45750561-45750583 TTTTTTAATCAGTCATTGGCTGG + Intergenic
973133871 4:46681935-46681957 TCTTTTAATTAATCAATGGCTGG + Intergenic
974416373 4:61612394-61612416 TCTTTTCACCATCTAGTGGCTGG - Intronic
974764919 4:66331217-66331239 TTTTTTCATCATTCAGTGACTGG - Intergenic
981726071 4:147848594-147848616 TCTTTTAACATTTCATTGGCAGG + Intronic
984796670 4:183667215-183667237 TCTTTTATGCATTCAGTTATGGG + Intronic
984896136 4:184541679-184541701 TCTTCTAAGTATCCACTGGCTGG - Intergenic
985571929 5:651643-651665 TCTTTTAAGAATTGTGTGCCGGG + Intronic
987537634 5:19208674-19208696 ACTTCTGAGCATGCAGTGGCAGG - Intergenic
987623887 5:20372130-20372152 GCTTTTAAGCATTAAGCTGCTGG + Intronic
987636857 5:20554441-20554463 TGATTTAAGAATTCAGTGGGAGG - Intronic
988365691 5:30295344-30295366 TATTTTAAATATTCAGTGGAGGG + Intergenic
989553805 5:42767726-42767748 TTTTTGAAACATTCAGTTGCAGG + Intronic
990487435 5:56273094-56273116 TTTTTTCAGCATTCATTAGCTGG - Intergenic
991077421 5:62556439-62556461 CATTTTAAGGTTTCAGTGGCTGG + Intronic
994130257 5:96219286-96219308 TCTATTATGCATTCAGGAGCTGG + Intergenic
994594393 5:101812703-101812725 TTTTTTAAGCATTTAGTAGCTGG - Intergenic
997215319 5:132105094-132105116 TCTTGTAACCATACAGTGGATGG - Intergenic
998443476 5:142180900-142180922 TCTTTAATTCATTCTGTGGCTGG + Intergenic
999631314 5:153574340-153574362 TTTTTGAAGTGTTCAGTGGCTGG + Intronic
1002197378 5:177508821-177508843 TTTGTAAAGCATCCAGTGGCCGG + Intronic
1003266313 6:4567756-4567778 TTTCTTAAGGATTGAGTGGCAGG + Intergenic
1007949791 6:45860965-45860987 TCTTTAAAGGATTCAGTAACTGG - Intergenic
1008602851 6:53112586-53112608 TTATTTAATCATTCATTGGCTGG - Intergenic
1009261616 6:61497424-61497446 TCCTTTAAGCACTCAGTTTCTGG + Intergenic
1009655407 6:66538862-66538884 TCTTTTAAGCCATCAGATGCTGG - Intergenic
1010279207 6:74004471-74004493 TGTTTTAAACATCCATTGGCTGG + Intergenic
1011562335 6:88633223-88633245 CCTTTTATGTATTCAGTGGGGGG - Intronic
1011641384 6:89419146-89419168 TGTTTTAATCATTAAGTGGCTGG + Intergenic
1012299610 6:97569624-97569646 GTTTCTAAGAATTCAGTGGCAGG + Intergenic
1012580400 6:100862180-100862202 TATTTTAAGAATACAGAGGCAGG - Intronic
1013360024 6:109385216-109385238 TCTTATAGGCATTCAGGGGTGGG + Intergenic
1015360972 6:132338832-132338854 TTATTTAAGCATTCAATGGCTGG + Intronic
1015506983 6:133998835-133998857 TCCTTTAAACATTTTGTGGCTGG - Intronic
1015826438 6:137317349-137317371 CCTTTTAAGGATGCACTGGCTGG - Intergenic
1016271766 6:142298287-142298309 TATTTTAACCATTCAGTGTCTGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018646943 6:165957739-165957761 TATTTTAAGCTTTTAGAGGCTGG - Intronic
1022039501 7:26566802-26566824 TGTTTTGTGCATTCTGTGGCTGG + Intergenic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1024688898 7:51778416-51778438 TCCTTTAAGCATTCACTGCCCGG - Intergenic
1028257156 7:88613267-88613289 TATTTTAAACAATCATTGGCAGG + Intergenic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1030777863 7:113557695-113557717 TATTTTAAATATTCACTGGCTGG + Intergenic
1030806401 7:113925372-113925394 TTTGTTAACCATTCAGTGGCAGG + Intronic
1032606285 7:133357875-133357897 ACTTTGAAACATTCTGTGGCAGG - Intronic
1032783303 7:135181848-135181870 TCTTTTAAGCATTTTGAGGCAGG - Intergenic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1036077033 8:5513584-5513606 GTTCTTAAGCATTCACTGGCAGG + Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039367821 8:36950276-36950298 TCTTCTCAGCATGCCGTGGCTGG - Intergenic
1039822821 8:41148739-41148761 TCATTTCAGGATGCAGTGGCGGG + Intergenic
1041719532 8:60963759-60963781 TTTTTTAAGCATTCATTCCCAGG - Intergenic
1046564806 8:115885472-115885494 TGTTTTAAGCATTCCGTAGATGG + Intergenic
1053168921 9:35864575-35864597 TGTTTTAAGGATCCAGTGACAGG + Intergenic
1054916012 9:70495958-70495980 TCTTTTAAGAAAACAGTAGCTGG - Intergenic
1055317722 9:75050805-75050827 TCTAATAAGCATTCACAGGCCGG + Intergenic
1057452244 9:95175134-95175156 TCTTTTAAGGATACGGAGGCAGG - Intronic
1058419078 9:104817650-104817672 TCATTGCAGCATTCATTGGCAGG - Intronic
1061107270 9:128541029-128541051 TCTTTTAACCATTAAGTGTTGGG + Intronic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1189832918 X:44992887-44992909 TATTTTAAGTCTTCATTGGCTGG + Intronic
1190434454 X:50409604-50409626 TCTTTAAAGCTTTCAGTGTGTGG + Intronic
1194547063 X:95249829-95249851 TCTTTTACTCATTCACTGTCAGG - Intergenic
1195095949 X:101501269-101501291 TCTTGTATGCATCAAGTGGCAGG - Intronic
1198617134 X:138471363-138471385 TCTTTTAAATATACAATGGCTGG - Intergenic
1199188859 X:144947356-144947378 TCACTTACACATTCAGTGGCTGG - Intergenic
1201051402 Y:9939728-9939750 TTTTTTAATCATTTATTGGCTGG - Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic