ID: 1078076104

View in Genome Browser
Species Human (GRCh38)
Location 11:8162277-8162299
Sequence AAAGTCAGCTTGACTAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078076104_1078076105 7 Left 1078076104 11:8162277-8162299 CCTGTCTTAGTCAAGCTGACTTT 0: 1
1: 0
2: 0
3: 11
4: 177
Right 1078076105 11:8162307-8162329 CTTGTCACAAGCACCCTAACTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1078076104_1078076108 30 Left 1078076104 11:8162277-8162299 CCTGTCTTAGTCAAGCTGACTTT 0: 1
1: 0
2: 0
3: 11
4: 177
Right 1078076108 11:8162330-8162352 TGAACCCAATGACAATGACTTGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078076104 Original CRISPR AAAGTCAGCTTGACTAAGAC AGG (reversed) Intronic
900491865 1:2953429-2953451 AAAGCCAGCTTGAATTAGAGTGG + Intergenic
905935821 1:41823403-41823425 CAAGTCAGTCTAACTAAGACTGG - Intronic
906859430 1:49343002-49343024 AAAGTCAGATTAACTAAAAGTGG + Intronic
908486366 1:64598015-64598037 AGAGTCACCTTGCCAAAGACAGG - Intronic
909575763 1:77174285-77174307 AAAGTCAGCTTAATTAAAAGTGG + Intronic
909662269 1:78097317-78097339 AAACTCTGCCTCACTAAGACTGG - Intronic
910226699 1:84943289-84943311 AAACTCAGTTTGCCCAAGACAGG - Intronic
911711601 1:101079704-101079726 AATGTCATGTAGACTAAGACTGG + Intergenic
914373138 1:147048808-147048830 TAAGTCAGCTTGACAATGAATGG + Intergenic
918825601 1:189319776-189319798 AAAGTCAGCCTGACACAGAAAGG + Intergenic
919003798 1:191869845-191869867 AAAGTCAGCTTAATTAAAAGCGG - Intergenic
920157780 1:203969312-203969334 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
922888051 1:229035723-229035745 AAAGTCAGCCTGATTAAACCAGG + Intergenic
923218877 1:231875152-231875174 AAATTCAGCTTGCCACAGACAGG - Intronic
924483282 1:244455537-244455559 AAAGTCAGCTTAATTAAAAGTGG + Intronic
924717552 1:246591681-246591703 AAAATCAGCTTGACGGGGACGGG + Exonic
924808685 1:247382232-247382254 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1065524598 10:26607091-26607113 TAAGTCTGCTTGAAGAAGACGGG + Intergenic
1065532357 10:26685251-26685273 TAAGTCGGCTTGAGGAAGACGGG + Intergenic
1069149228 10:64934592-64934614 AAAGTCTGCTTCCCTAATACTGG - Intergenic
1071191420 10:83105778-83105800 AAAGAGAGCTTAACTAAAACTGG - Intergenic
1072935930 10:99713454-99713476 AAAGTAAAGTTGAATAAGACAGG + Intronic
1075264983 10:120992439-120992461 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1075476185 10:122736190-122736212 AAAGTCACCTGAACTAAGGCAGG + Intergenic
1076744721 10:132507161-132507183 AAGGTCACCTTGGCTAACACAGG + Intergenic
1077749470 11:4949084-4949106 AAAGTAAGCTACAGTAAGACAGG + Intronic
1078076104 11:8162277-8162299 AAAGTCAGCTTGACTAAGACAGG - Intronic
1079412576 11:20202946-20202968 AAAGTCAACTTAACTAAAAGTGG + Intergenic
1083029636 11:59580283-59580305 AAATTCAGTTTTATTAAGACTGG + Intronic
1083504089 11:63139047-63139069 AAAGTCAGCTTAATTAAAAGTGG + Intronic
1084878612 11:72153324-72153346 AAAGTCAGCTTCATTAAAGCAGG - Intergenic
1085580198 11:77643631-77643653 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1086488804 11:87337650-87337672 AAGGACAGCTTGACTAAAAAAGG + Intergenic
1089160581 11:116434106-116434128 ACTGTCACCTGGACTAAGACTGG - Intergenic
1091072207 11:132578063-132578085 AAAGTCTGCTTTTATAAGACAGG - Intronic
1093616482 12:21231813-21231835 AAAGTCAGCTTAATTAAAAATGG - Intronic
1094431351 12:30373314-30373336 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1094498460 12:31003828-31003850 AAAGACAGCTTCTCTGAGACAGG - Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1095615847 12:44187546-44187568 AAATTCAGATTGAATAAGATGGG + Intronic
1099402087 12:82212455-82212477 AAAGTCAGCTTAATTAAAATTGG + Intergenic
1099781877 12:87205411-87205433 AAAGTCAGTTTCACTAAAAGAGG + Intergenic
1102397419 12:112598864-112598886 AAAGTCTCCTTGCCTAATACTGG + Intronic
1102646579 12:114407719-114407741 AGATTCAGCAAGACTAAGACGGG + Intronic
1104131298 12:125896900-125896922 AAAGTCAGCTTGATTCGGAATGG + Intergenic
1107012204 13:35680439-35680461 AAAATCAACTTGATTAAGACCGG + Intergenic
1107454475 13:40541605-40541627 AAAGTATTCTTGACAAAGACTGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109609103 13:64739960-64739982 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1115981951 14:39062741-39062763 ACAGTCAGCTTTCCTAAGGCAGG - Intronic
1117078174 14:52125120-52125142 ACACTCAGCTTTACTGAGACTGG - Intergenic
1122596565 14:102897552-102897574 AAAGGCAGCTGGACTAGCACAGG + Intronic
1123771286 15:23531895-23531917 AAAGTCAGCTTAACTAGGATAGG - Intergenic
1127379828 15:58421012-58421034 AGAGTTAGCTGGGCTAAGACAGG + Intronic
1128640537 15:69332995-69333017 AAAGTCAGCTTAATTAAAAGTGG + Intronic
1130977442 15:88788329-88788351 TAAGTGAGCTTGACTCAGATAGG - Intergenic
1130999039 15:88923544-88923566 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1131696125 15:94880065-94880087 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1131836243 15:96394303-96394325 AAAGTCAGAATTACTAAGCCTGG - Intergenic
1133627911 16:7589476-7589498 AAAGGCAGCTTCACAAAGTCAGG - Intronic
1137711783 16:50571772-50571794 AAAGTCAGCCTGGCTGAGGCAGG - Intronic
1139005321 16:62563337-62563359 AAAGTCAAATTGACCAAGCCTGG + Intergenic
1140888310 16:79263606-79263628 AAAGACACTTTGACTAAGATTGG - Intergenic
1142121895 16:88390550-88390572 AAAGTCAGCTTGCCTAGGAAGGG - Intergenic
1147038174 17:37697520-37697542 AAAGTCAACTTGGGAAAGACAGG + Intronic
1152507556 17:80760596-80760618 AAAGAAAGCTTGACTGAGGCTGG - Intronic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1161500913 19:4615034-4615056 AATGTCAAGTTGACTATGACTGG - Intergenic
1161884530 19:6983676-6983698 AAAGAGAGCATGAATAAGACAGG - Intergenic
925180050 2:1811702-1811724 AAAGACAGCTTGAGTAGCACAGG - Intronic
926839067 2:17058400-17058422 AAAGTCTGCTTGAGAAATACAGG + Intergenic
927767934 2:25830200-25830222 AATGCCAGCTTAAATAAGACTGG + Intronic
927835022 2:26389058-26389080 AAACTCAGATTGACTAGGAATGG + Exonic
928459265 2:31455518-31455540 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
928657618 2:33469093-33469115 AAAGTCAGCTTCCCTAAAAAAGG - Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
932562218 2:72883186-72883208 AATGTAAGCTTGAGGAAGACAGG + Intergenic
935255199 2:101304061-101304083 AAAGTAAGCTTGACCAAGGTAGG - Intronic
935885832 2:107618050-107618072 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
939486824 2:142824710-142824732 CAAGTCAGATTTTCTAAGACAGG - Intergenic
943000855 2:182327122-182327144 AATGTCAGCTCTACTAAAACAGG - Intronic
943758767 2:191586314-191586336 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
946114135 2:217446833-217446855 AAAGTCAGAGTGAATAAGTCAGG + Intronic
946891591 2:224282613-224282635 AATGTCAGGTTGAAGAAGACTGG - Intergenic
947334750 2:229069855-229069877 AAAGTCAGTTTGAATAATAGAGG - Intronic
1170098702 20:12675122-12675144 AAAGTCAGATTTTCTAAGACTGG + Intergenic
1170716272 20:18833673-18833695 ATAGTCAGCTTAAATAAGAAAGG + Intergenic
1177493409 21:21857487-21857509 ATATTCAGATTGACTAAGATAGG - Intergenic
1177555089 21:22678882-22678904 AAAAACAGCTGGACTATGACTGG + Intergenic
1180683139 22:17643044-17643066 AAAGTCAGATTATCTAGGACGGG + Intronic
1183325865 22:37193563-37193585 AAAGTCAGCTTAATTAAAAATGG - Intronic
949962833 3:9328462-9328484 AAAGTCAGCTTAATTAAAAGTGG - Intronic
951256104 3:20451707-20451729 AAAGTCAGCTTAACTAAAAGTGG - Intergenic
951821772 3:26821820-26821842 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
952041354 3:29265750-29265772 CAAGTCAGCTTGAGTTACACAGG + Intergenic
952294705 3:32050993-32051015 AAAGTCAGCTTAATTAAAAGTGG + Intronic
954824554 3:53361305-53361327 CAACTCAGATGGACTAAGACAGG - Intergenic
955756697 3:62231981-62232003 AAATACAGTTTGCCTAAGACAGG - Intronic
957376287 3:79363199-79363221 AAACTCATCATGGCTAAGACTGG - Intronic
957590164 3:82186266-82186288 AAAGGCAGCTGGACGATGACAGG - Intergenic
957697805 3:83665375-83665397 AAAATCAGCGTGACTGAAACAGG - Intergenic
957724590 3:84047660-84047682 AAAGTCAGCTTAATTAAAAGAGG + Intergenic
958967868 3:100579298-100579320 AATGTAAGCTTGATGAAGACTGG - Intergenic
960386725 3:117029429-117029451 AAAGTCAGCTTAATTAAAAGTGG + Intronic
960460658 3:117930789-117930811 AAAGAAAGCCTGTCTAAGACTGG + Intergenic
961595799 3:128015289-128015311 AAAGTCAGCTTAATTAAAACTGG + Intergenic
964001890 3:151784776-151784798 AAATTCATGTTGACTAAAACTGG - Intergenic
965205647 3:165717189-165717211 AAAGTCAGCTTAACTAAAAGTGG - Intergenic
965278906 3:166723305-166723327 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
965585849 3:170317629-170317651 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
966212706 3:177469544-177469566 GAAGTCTGCTTTTCTAAGACAGG + Intergenic
967266211 3:187694483-187694505 AAAGGCAGCATGACTAAAGCTGG - Intergenic
970963946 4:21906319-21906341 AAAGTGTCCTTGTCTAAGACAGG + Intronic
971593977 4:28504200-28504222 AAAGTCAGCTAGAATATGGCAGG - Intergenic
973268697 4:48237385-48237407 AAAGTCATATTGACTAGGATAGG - Intronic
973814142 4:54603369-54603391 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
974203716 4:58672027-58672049 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
976643576 4:87364015-87364037 AAAGTCAGCTTAATTAAAAGTGG + Intronic
977589856 4:98814222-98814244 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
977674260 4:99730868-99730890 AAAGTCAGCTTAATTAAAAATGG - Intergenic
978844197 4:113252485-113252507 AAAGTCAGCAAGAATAAGAAGGG - Intronic
978871168 4:113579886-113579908 AAAGTCAGCTTTCCAAATACAGG + Intronic
979170402 4:117594947-117594969 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
979886925 4:126039772-126039794 AAATTCAAATTGATTAAGACTGG - Intergenic
983658968 4:170112861-170112883 AAAGTCAACTTAATTAAAACAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
983899628 4:173120042-173120064 AAAGTCAGCCCAACCAAGACTGG - Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
987167578 5:15217133-15217155 CATGGCAGCTTGACTAAGGCTGG + Intergenic
989337001 5:40329903-40329925 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
990727104 5:58768142-58768164 AAAGTCAGCATGTTCAAGACAGG - Intronic
991034856 5:62118972-62118994 AAAGTCACCTTGGATATGACAGG + Intergenic
992267686 5:75034410-75034432 AGAGTCAGCTGGGCTAAGGCTGG + Intergenic
992706943 5:79405477-79405499 AAAGCCAGCTTGATTAGAACAGG - Intronic
993745531 5:91592567-91592589 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
994273188 5:97806447-97806469 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
994562641 5:101395638-101395660 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
996698699 5:126426724-126426746 ACATTCAGCTTGACTATGTCAGG + Intronic
998258701 5:140611064-140611086 AAAGGCAGCTCAACAAAGACAGG + Intergenic
1003343915 6:5247349-5247371 AAAGACAACTGGACTAAGACAGG + Intronic
1004994206 6:21172346-21172368 GAAGGCAGCATGACTATGACTGG - Intronic
1005281674 6:24281278-24281300 AAAGTAAACTAAACTAAGACAGG + Intronic
1006290887 6:33135774-33135796 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1008589079 6:52975367-52975389 AAAGTCAGCATGAGTGAGACAGG - Intergenic
1010104084 6:72147714-72147736 AAAGTCAGCTTAATTAAAAGTGG - Intronic
1010855918 6:80839113-80839135 GATGTCAGATTGACTGAGACTGG + Intergenic
1011341569 6:86320987-86321009 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1013546725 6:111165486-111165508 AAAGTCAGCTTAATTAAAAGTGG - Intronic
1013951492 6:115787853-115787875 AAAGTTAGGTTGAATAAAACTGG - Intergenic
1015920462 6:138261364-138261386 TAAATCAGCTTTACTAAGATTGG + Intronic
1018801899 6:167229281-167229303 AAAGTCAGCTTGATTAAAAGTGG + Intergenic
1022733605 7:33055538-33055560 AAATTCAGCTTGACTGAAATAGG + Intronic
1027525341 7:79261856-79261878 AAAGTCATGTTGATTAAGATAGG - Intronic
1027960878 7:84943301-84943323 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1029211985 7:98916735-98916757 AGGGTCAGCTTGAATGAGACCGG - Intronic
1029811064 7:103049695-103049717 AAAGTCAGCTTAATTAAAAGTGG - Intronic
1032765602 7:134989384-134989406 AAAGTCAGATTGAATAATATAGG + Intronic
1036713234 8:11096611-11096633 AAAGGCTGCTTGACTAACATCGG - Intronic
1037114845 8:15211958-15211980 AAAGTCAGACTGATTAAGAAAGG + Intronic
1038101878 8:24387211-24387233 TAATTCCACTTGACTAAGACAGG + Intronic
1039363245 8:36902919-36902941 AAGGTCAGCTTGACCAAAATGGG - Intronic
1040089717 8:43385354-43385376 AAAGTCAGCTTAATTAAAATAGG - Intergenic
1043734714 8:83729104-83729126 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1044439583 8:92207976-92207998 AAAGTCAGCTTAATTAAAAATGG - Intergenic
1045179586 8:99765790-99765812 AAAGTAAACTGGAATAAGACAGG - Intronic
1045428274 8:102088462-102088484 AAAGTCAGCTTAATTAAAAGTGG + Intronic
1045969786 8:108066864-108066886 AATCTCAGCATGACTAAGAATGG + Intronic
1046221441 8:111221701-111221723 AAAGCCAGAATGATTAAGACAGG + Intergenic
1048956229 8:139538732-139538754 CATTTCAGCTTGAATAAGACAGG - Intergenic
1050401607 9:5262050-5262072 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1052971917 9:34381719-34381741 AGAGTCAGCTAGACAAAGAGGGG - Intronic
1058355760 9:104082009-104082031 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1058552090 9:106125557-106125579 AAGGTCAGATTGACAAAGAATGG + Intergenic
1059690173 9:116677069-116677091 AAAGTCAGCTTAATTAAAAGTGG + Intronic
1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG + Intronic
1186285671 X:8041645-8041667 AAGTTAAGCTTGATTAAGACAGG - Intergenic
1188687068 X:33082212-33082234 AAAGTCAGCTTAATTAAGAGTGG - Intronic
1190137695 X:47812321-47812343 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1191823131 X:65335300-65335322 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1193954252 X:87839043-87839065 ATAGTCAGCTAGACTTAGTCAGG - Intergenic
1194138413 X:90177272-90177294 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1194187797 X:90794665-90794687 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1195112960 X:101665793-101665815 AGAGTTAGCTTGACTGAGAAAGG + Intergenic
1197396869 X:125938448-125938470 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1198181983 X:134219273-134219295 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1199994648 X:153014136-153014158 AAAGTCAGCTTAATTAAAAGCGG - Intergenic
1200484213 Y:3747509-3747531 AAAGTCAGCTTAATTAAAAGTGG - Intergenic
1200534384 Y:4376614-4376636 AAAGTCAGCTTAATTAAAAGTGG + Intergenic
1201285828 Y:12377769-12377791 AAAGTCATCATGACTTATACGGG + Intergenic