ID: 1078084415

View in Genome Browser
Species Human (GRCh38)
Location 11:8225100-8225122
Sequence GTGGGGAGACAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 1, 1: 1, 2: 7, 3: 89, 4: 888}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078084404_1078084415 26 Left 1078084404 11:8225051-8225073 CCCAGTCCCAGAGAGGGAGAAAG 0: 1
1: 1
2: 5
3: 61
4: 436
Right 1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG 0: 1
1: 1
2: 7
3: 89
4: 888
1078084403_1078084415 27 Left 1078084403 11:8225050-8225072 CCCCAGTCCCAGAGAGGGAGAAA 0: 1
1: 1
2: 1
3: 37
4: 356
Right 1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG 0: 1
1: 1
2: 7
3: 89
4: 888
1078084408_1078084415 20 Left 1078084408 11:8225057-8225079 CCCAGAGAGGGAGAAAGGGAAAG 0: 1
1: 4
2: 18
3: 154
4: 1063
Right 1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG 0: 1
1: 1
2: 7
3: 89
4: 888
1078084409_1078084415 19 Left 1078084409 11:8225058-8225080 CCAGAGAGGGAGAAAGGGAAAGC 0: 1
1: 0
2: 5
3: 81
4: 704
Right 1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG 0: 1
1: 1
2: 7
3: 89
4: 888
1078084405_1078084415 25 Left 1078084405 11:8225052-8225074 CCAGTCCCAGAGAGGGAGAAAGG 0: 1
1: 0
2: 5
3: 40
4: 371
Right 1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG 0: 1
1: 1
2: 7
3: 89
4: 888

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078084415 Original CRISPR GTGGGGAGACAGATGGAGAA AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900251880 1:1675192-1675214 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900262291 1:1738048-1738070 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900560877 1:3305498-3305520 GTGGGCAAACAGATGGGAAATGG - Intronic
900628815 1:3623132-3623154 GGGGGGAGAAAGAGGGAGAATGG - Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901113215 1:6816308-6816330 GGGGGAAGACAGATGGTAAATGG - Intronic
901140654 1:7027137-7027159 GTGGGAAAACAGTTGAAGAAGGG + Intronic
901154335 1:7125377-7125399 ATGGGGAGACAGAAGTAGATAGG + Intronic
901208067 1:7508676-7508698 GTGGGGCAAGAGATGAAGAATGG + Intronic
901314118 1:8294172-8294194 GTGGGGAGACACACGCAGGAGGG - Intergenic
901625617 1:10623189-10623211 GAGTGGAGACAGAGGGAGAGGGG - Intronic
901737861 1:11323736-11323758 GTGGGGAGCCTGAGGGAGAGGGG + Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901849634 1:12007309-12007331 GTGGGAAGAGAGATGGGGAAGGG - Intronic
901853568 1:12030475-12030497 GTGGGGAGACCGAAGCAGAGGGG + Intronic
902114140 1:14107062-14107084 GAGGGGAGAGAGATGAAGGAAGG - Intergenic
902201499 1:14836712-14836734 GTGGGGAGGGAAATGGAGAGGGG + Intronic
902299725 1:15493443-15493465 GTGAGGAAACAGATAGGGAAGGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902618500 1:17636978-17637000 GTGATGATACAGATGGAGTAAGG - Intronic
902722855 1:18315650-18315672 ATGGGTAGATGGATGGAGAATGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
903105756 1:21078460-21078482 GTGGTGAGACATATGAAGACTGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903321735 1:22547467-22547489 CGGGGGAGAGAGATGGAGAGAGG - Intergenic
903383437 1:22912020-22912042 GGGTGGAGAAGGATGGAGAATGG + Intronic
903626107 1:24731260-24731282 GTGGGGAGACTGCTGGACACAGG + Intergenic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
903965851 1:27088934-27088956 GGAGGGAGGCAGAGGGAGAAGGG + Intergenic
904083266 1:27885476-27885498 GAGGGGAGACACAAGGACAAGGG - Intronic
904254183 1:29244092-29244114 CTGGGGAGAAAGATTGAGATGGG + Intronic
904888064 1:33756648-33756670 GCAGGGTGACAGATGGAGCAAGG + Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
905362309 1:37429590-37429612 GGGGAGAGAGAGAGGGAGAAGGG - Intergenic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905720130 1:40191876-40191898 ATGGGGAGACAGGTGAAGAGAGG + Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
906298705 1:44665259-44665281 GTGGAGAGACAGATAGGGAGGGG + Intronic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906976650 1:50581567-50581589 CTGGGAAGACATATGTAGAATGG + Intronic
907167209 1:52424146-52424168 GTGGGGAGAAAAATGAAGAAGGG + Intronic
907505888 1:54918074-54918096 GAGGAGAGAGAGATGGAGGAGGG - Intergenic
907866314 1:58402649-58402671 GGGGGGAGAGAGAGGGAGAGAGG + Intronic
907927829 1:58971242-58971264 ATGAGGAGACAGATGCAAAAAGG - Intergenic
908013716 1:59810119-59810141 GAGGGAAGAAAGAGGGAGAAAGG - Intergenic
908339421 1:63161306-63161328 GTGGGGAGACAGATTGGGGCTGG + Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908415215 1:63906778-63906800 GTGGTGAGCAAAATGGAGAATGG - Intronic
908962809 1:69721123-69721145 GTGTGGGGATAGATGGTGAATGG - Intronic
909169731 1:72280928-72280950 GTGGGGTGGCAGGGGGAGAAGGG + Intronic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
909480583 1:76125468-76125490 GAGGGGAGAGAGGTGGAGGAGGG - Intronic
909700386 1:78514862-78514884 GAGGGGAGCAAGAAGGAGAAGGG - Intronic
910368692 1:86493302-86493324 CTGGGGAGACAGGGGCAGAAGGG + Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911562918 1:99428612-99428634 GTGGAGAGAGAGAGGGAGAGAGG - Intergenic
911898517 1:103470608-103470630 GTGCAAAGACAGATGTAGAAAGG - Intergenic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
912974972 1:114321317-114321339 GTGGGGAGGCAGAGAGAGTAGGG + Intergenic
913053252 1:115135022-115135044 GTGGGGAGACCGAGGGATCAGGG + Intergenic
913062410 1:115220444-115220466 GAGGGGAAACAAATGGAGACTGG + Intergenic
914897866 1:151692948-151692970 GATGGGACACAGATGAAGAAGGG + Exonic
915012965 1:152706931-152706953 ATTGGGAGAGAGATGGAAAATGG + Intergenic
915300451 1:154948410-154948432 ATGGGGAGACACAGGGAGAGAGG + Intronic
915682405 1:157594369-157594391 GTAGGGAGACAGGTGGAGAAGGG - Intronic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
916126414 1:161575449-161575471 GTGAGGAGTCAGAAGCAGAAGGG - Intergenic
916136333 1:161657289-161657311 GTGAGGAGTCAGAAGCAGAAGGG - Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
916875023 1:168959883-168959905 GTGGGGAGAGAGATGGGGTAGGG - Intergenic
917020182 1:170578365-170578387 GTGGGAAGAGAGTTGGTGAAGGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917742432 1:177973966-177973988 GTGGAGAGACTGGAGGAGAAGGG + Intronic
917925044 1:179782347-179782369 GTGGGGGCAGAGATGGGGAAGGG + Intronic
917972812 1:180219572-180219594 GTGGGGAGGAACCTGGAGAAGGG - Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918707283 1:187681126-187681148 GTGGGGAGAAAGAGAGAGTAGGG - Intergenic
919819140 1:201462013-201462035 GTGGGGAGACCGAGGGAGAAGGG - Intergenic
919928852 1:202208403-202208425 GGGGGGAGAGAGAGAGAGAAGGG + Intronic
920167618 1:204046717-204046739 TTGTGGAGGCTGATGGAGAAAGG + Intergenic
920267017 1:204731589-204731611 CTGGTGAGAGAGATGGAGAGAGG - Intergenic
920301387 1:204991248-204991270 ATGGCCAGACAGAGGGAGAAAGG - Intronic
920387692 1:205580234-205580256 GGGGGGAGAAAGACGAAGAAAGG - Intronic
920584749 1:207146679-207146701 GTGGGCAGTAAGATGGAGAAGGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920970691 1:210741442-210741464 GTGGGGAGGCGAAAGGAGAAAGG + Intronic
921009119 1:211123633-211123655 GAAGACAGACAGATGGAGAAAGG + Intronic
921274238 1:213502247-213502269 CTGGGATGACAGATTGAGAATGG + Intergenic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
921633915 1:217468800-217468822 GTGGGGATACAGATGAAACAGGG + Intronic
922993162 1:229932577-229932599 GTGGGGAGACAGAGAGGGAGAGG + Intergenic
923220815 1:231891462-231891484 GTCAGGAGACAGACGGAGCAGGG + Intronic
923554615 1:234990926-234990948 GAGGGGTGGCGGATGGAGAAGGG - Intergenic
923986329 1:239386786-239386808 GGCGGGAGACAGAGGGAAAAGGG + Intronic
924471753 1:244348991-244349013 GACCGGAGACAGATGGAAAACGG + Intergenic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
1062922865 10:1293102-1293124 GGGGGGAGAGAGAAAGAGAAAGG + Intronic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063582649 10:7322695-7322717 GTGGGGAGGCGAATGGACAAAGG + Intronic
1063975844 10:11415005-11415027 GTTTTGAGACAGATGGGGAAGGG - Intergenic
1064322382 10:14317708-14317730 GAGGGGAGAGGGAAGGAGAAAGG + Intronic
1064364689 10:14697055-14697077 ATGGGGAGGCACAGGGAGAAAGG + Intronic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064786303 10:18900942-18900964 GTTGGGGGATGGATGGAGAATGG - Intergenic
1065283657 10:24165997-24166019 GTGGGGAGGAGGATGGAGCATGG - Intronic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1066444491 10:35469608-35469630 GTGGAGAGACAGATAGACAGGGG + Intronic
1066538902 10:36422637-36422659 GTGAGAAGAAAGAGGGAGAAAGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067816114 10:49477914-49477936 GTGTGGAGACAAATGAAGCAGGG - Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068632765 10:59314662-59314684 AAGGGGAGAAAGATTGAGAAGGG - Intronic
1068679716 10:59806673-59806695 GTGGGGAGAGAAATGGAGACAGG - Intronic
1068858885 10:61826509-61826531 CTCTGGAGACAGATGGAGACTGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1070322732 10:75366531-75366553 GTGGGGACACAGAGGCAGAGCGG - Intergenic
1070373423 10:75806911-75806933 GGGGAAAGACAGATGCAGAAAGG - Intronic
1070383755 10:75904981-75905003 GAGGGGAGAGAGGGGGAGAAAGG + Intronic
1070504792 10:77103772-77103794 GAGGGGAAAAAGATGGAGAGGGG - Intronic
1070523437 10:77274885-77274907 GTGGGGAGAGAAACTGAGAAGGG + Intronic
1070653834 10:78257102-78257124 CTGAGGAGACAAGTGGAGAAAGG + Intergenic
1071738704 10:88331923-88331945 GAGGGGAGAAAGATGGGAAAGGG + Intronic
1072231040 10:93414211-93414233 GGGAGGACACAGAAGGAGAAAGG - Intronic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1072758802 10:98039010-98039032 GTGGGGAGAAAGAGGAAGAGTGG + Intergenic
1072896076 10:99367938-99367960 GTGGGGAAAGAGAAGGACAATGG + Intronic
1073038176 10:100578817-100578839 GAGGGGAGACAGAGAGAAAAGGG + Intergenic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1073562364 10:104507765-104507787 GTGGGGAGATCCATGGAGTATGG + Intergenic
1073599620 10:104834083-104834105 CTGGGGAGACAGGTGAAGAGGGG - Intronic
1074403427 10:113161104-113161126 GAGTCGAGACACATGGAGAAGGG + Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074532358 10:114306031-114306053 GAGGGGACACAGATGCAGAAGGG + Intronic
1075639319 10:124053378-124053400 AGGGGGAGACAGGTGGAGCAGGG + Intronic
1075808018 10:125204055-125204077 GTGGGGAGAGAGGTTGAGAAGGG - Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1075938319 10:126363686-126363708 GATGGGAGAGACATGGAGAAGGG + Intronic
1076045086 10:127286024-127286046 GTGGGAAGCCAGCTGGAAAAAGG - Intronic
1076084784 10:127617689-127617711 CTGGGCAGAAAGGTGGAGAATGG + Intergenic
1076109167 10:127848261-127848283 GTGGGGGGACAGAGAGAGAGAGG + Intergenic
1076595593 10:131623053-131623075 GTGGGGGGAGAGATGGGGAGAGG + Intergenic
1076596014 10:131624149-131624171 TGGGGGAGAGAGATGGAGAGAGG + Intergenic
1076596055 10:131624263-131624285 TGGGGGAGAGAGATGGAGAGAGG + Intergenic
1076596106 10:131624396-131624418 TGGGGGAGAGAGATGGAGAGAGG + Intergenic
1076596156 10:131624529-131624551 TGGGGGAGAGAGATGGAGAGAGG + Intergenic
1076596172 10:131624574-131624596 TGGGGGAGAGAGATGGAGAGAGG + Intergenic
1076596290 10:131624848-131624870 TGGGGGAGAGAGATGGAGAGAGG + Intergenic
1076596330 10:131624952-131624974 TGGGGGAGAGAGATGGAGAGAGG + Intergenic
1076598340 10:131639600-131639622 GGAGGGTGACAGAGGGAGAAAGG + Intergenic
1077181361 11:1218661-1218683 GTGGGGAGACAGGCAGAGAAGGG + Intergenic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1077554895 11:3221159-3221181 GAGGGGAGGGAGAAGGAGAATGG + Intergenic
1078043715 11:7893574-7893596 GTGGGGAGAGGGTAGGAGAAAGG - Intergenic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078096788 11:8302440-8302462 GAGGGGAGAGAGAAGAAGAAAGG + Intergenic
1078396762 11:10988339-10988361 GTTGGGAGACAGATTTAGAGTGG - Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078937246 11:15962927-15962949 GTGGGGAGCCTGCTGGAGATGGG + Intergenic
1079100603 11:17539271-17539293 GTGGGGAGACAGGAGGGTAAAGG - Intronic
1079407545 11:20159306-20159328 GAGGGGGGACAGAAGGAGAGAGG + Intronic
1079486962 11:20945204-20945226 GGGGGATGCCAGATGGAGAAGGG + Intronic
1079664834 11:23092410-23092432 GTAATGAGACAGATGGAGAGTGG + Intergenic
1080780091 11:35421072-35421094 GGGAGGGGAGAGATGGAGAAAGG - Intergenic
1080829421 11:35877412-35877434 GTTGAGAGACACATGGAGAAGGG + Intergenic
1081529400 11:43947681-43947703 GTTGAGAGACAGAAGGATAAAGG + Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082085966 11:48049794-48049816 GTGGGCAGACAGATTGACAGTGG + Intronic
1083016342 11:59457902-59457924 GTGAGCAGTCAGATGGAGAGTGG + Exonic
1083418869 11:62542542-62542564 GGGTAGAGAGAGATGGAGAAAGG - Intronic
1083742242 11:64717071-64717093 GTGGGGAGACCTCTGGAGAAAGG - Intronic
1083946865 11:65928496-65928518 CTGGGGAGACTGAGGCAGAAAGG - Intergenic
1083986493 11:66219211-66219233 GTGGTGTCACAGATGGAAAAGGG + Intronic
1084463776 11:69310486-69310508 GTGGGAAGACACAAGGAGATTGG - Intronic
1085149138 11:74234083-74234105 GTTGGGAGAGAGACGGGGAAGGG + Intronic
1085446362 11:76603661-76603683 GTGGGGAGACGGAGGGGAAAAGG + Intergenic
1085820093 11:79783240-79783262 GTGGGGAGACAGCTGTGGAAGGG + Intergenic
1086096465 11:83054771-83054793 GTGGGCAGACTGATTGAGCATGG + Intronic
1086128743 11:83378663-83378685 GTGTGAAGACACAGGGAGAAAGG - Intergenic
1086131747 11:83408695-83408717 GTGGGGAGAGTGGCGGAGAAGGG + Intergenic
1086480270 11:87228342-87228364 GAAAGGAGACAGATGTAGAAAGG - Intronic
1088271520 11:108039374-108039396 GTGGGGAGAAAGACACAGAAGGG - Intronic
1088734521 11:112717631-112717653 CTGGGGAGGCTGATGGAGATGGG + Intergenic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1089153193 11:116380496-116380518 TTGCAGAGACACATGGAGAAAGG - Intergenic
1089291289 11:117439214-117439236 GTGGGGACAGGGATGGAGAAAGG - Intronic
1089324434 11:117647638-117647660 GGCAGGAGACAAATGGAGAAAGG + Intronic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1090864944 11:130691408-130691430 GTGGAGAGAGAGAGGGAGCAAGG - Intronic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1091934171 12:4422349-4422371 GGGTGGAGAAGGATGGAGAAGGG + Intergenic
1092023484 12:5222027-5222049 GTGGGGAGAGGGCTGGGGAAGGG + Intergenic
1092082756 12:5731590-5731612 GTGGGGAGAGAGAGAGAGAGAGG - Intronic
1092134887 12:6140063-6140085 GTGAGAGGTCAGATGGAGAAAGG + Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092211777 12:6651052-6651074 GTGGGGAGAGGGGAGGAGAAGGG + Exonic
1093886455 12:24467044-24467066 CTGAGGAGACAGATAAAGAAAGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1093993273 12:25613959-25613981 GAGAGGAGACAGAAGGACAAAGG + Intronic
1094166172 12:27446281-27446303 GGGGAGAGAGAGATGGAGGAGGG + Intergenic
1094209582 12:27874917-27874939 TCGGGAAGACAGATGTAGAATGG - Intergenic
1094553879 12:31478605-31478627 GTGGGAAGACAGCTTGAGCACGG + Intronic
1094713117 12:32985444-32985466 GTGGGGAGGCAGAAGAAGAGGGG + Intergenic
1095564696 12:43608991-43609013 TTGGGGAGGGAGGTGGAGAAAGG - Intergenic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1096298190 12:50401448-50401470 GTGGGGCCACGGATGGAGAAAGG + Intronic
1096966135 12:55629561-55629583 ATCGGGAGACAGAGGGAGCAAGG + Intergenic
1097166613 12:57089469-57089491 GGGTGGAGACTGATGGAAAAGGG + Intronic
1097283514 12:57860483-57860505 GTGGGCAGCCAGGAGGAGAAAGG + Intergenic
1098384462 12:69904168-69904190 GTGGGGAGACAGAAAGGAAAAGG - Intronic
1100324925 12:93531648-93531670 GGGAGAAGACACATGGAGAAGGG - Intergenic
1100569877 12:95837496-95837518 GAGGGAAGAGAGATGGAGAGAGG + Intergenic
1100608656 12:96172199-96172221 GTGGTAAGACAGAATGAGAATGG - Intergenic
1100782764 12:98046997-98047019 AAGGGGAGAGAGATGGAGAGAGG + Intergenic
1101000736 12:100355206-100355228 GTGGGGAGAAAGAGGGAGGGAGG + Intergenic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101437537 12:104677013-104677035 GTCGGGAGAAGGTTGGAGAAGGG - Intronic
1101492502 12:105222498-105222520 GTGGAAGGCCAGATGGAGAACGG + Intronic
1101540213 12:105658328-105658350 CTGGGGAGATAAATGGGGAATGG + Intergenic
1101604164 12:106235126-106235148 GTGGGGAGTCGGGTGGAGATGGG - Intergenic
1101843924 12:108346555-108346577 GTGGGGAGAGACATGGGGAATGG + Intergenic
1102193468 12:111007020-111007042 CTCTGGAGACAGATGGAGAGAGG + Intergenic
1102635126 12:114316674-114316696 GGGTGGAGAAAAATGGAGAATGG + Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1102789813 12:115635842-115635864 GGAGGGAGAAAGAAGGAGAAAGG + Intergenic
1104297313 12:127528616-127528638 GGCGGGAGACAGATGAAGGACGG - Intergenic
1104310933 12:127653797-127653819 GAGGGCACAAAGATGGAGAAAGG + Intergenic
1104378448 12:128286020-128286042 GTGGGGAGAGAAAGAGAGAAAGG - Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104636458 12:130440555-130440577 GTGGGGAGTCAGGAGGTGAAGGG - Intronic
1104715475 12:131013360-131013382 GGAGGGAGACTGATTGAGAAGGG - Intronic
1104938242 12:132378530-132378552 GGGGGGAGAGAGAGGGAGAGAGG + Intergenic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1105847064 13:24302566-24302588 GAGGGGAGAGAGATGGAACAGGG - Intronic
1106075299 13:26455375-26455397 GTGGGGAGTGAGATGGTTAATGG + Intergenic
1106180344 13:27364303-27364325 TTTGTGAGAAAGATGGAGAAAGG - Intergenic
1106307774 13:28528632-28528654 GTGTGTGGACAGATGGAGACAGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106350658 13:28927012-28927034 CTGGGGAGTCAGGTGCAGAAAGG + Intronic
1106356978 13:28992259-28992281 TGGGGGAGGTAGATGGAGAAAGG + Intronic
1107165001 13:37273417-37273439 GAAGGAAGACAGATGGAGAAAGG - Intergenic
1107205417 13:37779878-37779900 GTGGGTAGAGGGCTGGAGAAGGG - Intronic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1107877620 13:44804645-44804667 GGGTGGAGAAAAATGGAGAATGG - Intergenic
1108180148 13:47832656-47832678 GTGGGGAGAGAGAGGCAGAACGG + Intergenic
1109614906 13:64820101-64820123 GAGGGGAGAGAGTTGGAGGAGGG + Intergenic
1109785730 13:67172435-67172457 ATGGGGAGTAAGATGAAGAATGG + Intronic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110174812 13:72543430-72543452 GGTTGGAGACTGATGGAGAATGG - Intergenic
1110336199 13:74333861-74333883 GTGGGGAGACAGATACAAAAAGG + Intergenic
1110868155 13:80420467-80420489 GTGGGGAGAAGGGGGGAGAAGGG - Intergenic
1112162769 13:96886327-96886349 GAAGGGAGAGAGATGGGGAAAGG + Intergenic
1112415327 13:99199930-99199952 GTGGGGAGGAAGATGGGGAGAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112570938 13:100592569-100592591 GTAGGGAGACAGTTACAGAAAGG - Intergenic
1112895670 13:104296974-104296996 GTAGGGAGACAGCTGTGGAAAGG - Intergenic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113589947 13:111491443-111491465 ATGGGGAGAGAGATGGGGAGAGG - Intergenic
1114600644 14:23953473-23953495 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114610328 14:24036164-24036186 GTGGGCAAGCAGATGCAGAAAGG + Intergenic
1114969450 14:28006967-28006989 ATGAGGTGACAGATGGACAAAGG - Intergenic
1114994920 14:28336763-28336785 GAGGGCAGAGAGTTGGAGAAGGG + Intergenic
1115454870 14:33590700-33590722 GATGTGAGCCAGATGGAGAAGGG + Intronic
1116731508 14:48628388-48628410 GAGGGGAGAGAGGGGGAGAAGGG - Intergenic
1117444835 14:55794213-55794235 GTGGGGAGAGAGAGAGGGAAAGG + Intergenic
1117764035 14:59061352-59061374 GTGGGGAGACAGAGTGGGTAAGG - Intergenic
1118279963 14:64419415-64419437 GTGGGGAGAGAGCAGGAGAGAGG + Intronic
1118355539 14:65010556-65010578 GTGGGCAGACAGATGGGGTGGGG - Intronic
1118546279 14:66893095-66893117 GTTGGGTGAGAGAAGGAGAAAGG - Intronic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1118893726 14:69929233-69929255 TGGGGGAGGCAGATGGAGTAGGG - Intronic
1120011391 14:79419602-79419624 GAGGGGAGAGAGAGAGAGAAAGG + Intronic
1120166466 14:81206827-81206849 GTGGAGAGAGGGAGGGAGAAGGG - Intronic
1120399282 14:84007713-84007735 GTAGGGAGACAAATGGTGAAAGG - Intergenic
1120677920 14:87443457-87443479 GGGGGGAGAGAGAGAGAGAAAGG + Intergenic
1120841089 14:89085400-89085422 TGGGGGAGAGAGAGGGAGAAAGG - Intergenic
1121507489 14:94487731-94487753 GTGGGGGGAGAGATGGAGTGGGG + Intronic
1121637771 14:95465436-95465458 GTGGGTAGATAGGTGGTGAAGGG + Intronic
1122171579 14:99880394-99880416 GTGGGAATACAGAGGAAGAAAGG - Intronic
1122212129 14:100180272-100180294 GTGGGGAGACAGAGAGGGAGAGG - Intergenic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1123057214 14:105576255-105576277 GGGGAGAGATGGATGGAGAAAGG - Intergenic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123081030 14:105695636-105695658 GGGGAGAGATGGATGGAGAAAGG + Intergenic
1123461004 15:20471672-20471694 GTGAGGGGAAACATGGAGAAAGG + Intergenic
1123657056 15:22528708-22528730 GTGAGGGGAAACATGGAGAAAGG - Intergenic
1124310969 15:28623884-28623906 GTGAGGGGAAACATGGAGAAAGG - Intergenic
1125245295 15:37629790-37629812 GGTGGAAGACAGATGGAAAAAGG - Intergenic
1125934171 15:43620240-43620262 GGGGAGATATAGATGGAGAATGG - Intergenic
1125947276 15:43719706-43719728 GGGGAGATATAGATGGAGAATGG - Intergenic
1126075527 15:44905182-44905204 GTGGGGAGATGGAAGAAGAATGG + Intergenic
1126082791 15:44982276-44982298 GTGGGGAGATGGAAGAAGAATGG - Intergenic
1126261754 15:46701413-46701435 GAGGAGAGACAGAGCGAGAAGGG - Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126454975 15:48851153-48851175 GGAGGGTGGCAGATGGAGAAGGG + Intronic
1126531781 15:49718798-49718820 GTTAGGAGACAGACGGAGAGTGG + Intergenic
1126593601 15:50364204-50364226 GCAGGGAGACAAATGGAGATAGG - Intergenic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1127123291 15:55789353-55789375 GTTGGGAGCCTGATGGTGAAGGG + Intergenic
1127773672 15:62249783-62249805 GTGGGGGCACAGATGGAAAGGGG + Intergenic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1129253387 15:74320623-74320645 GGGTGGTGACAGGTGGAGAAGGG + Intronic
1129363751 15:75041705-75041727 AGGGGGAGTGAGATGGAGAATGG + Intronic
1129743327 15:78000863-78000885 GTGGTCCCACAGATGGAGAAGGG - Intronic
1130040516 15:80402599-80402621 GTGGGGAGAAGGATCCAGAAGGG + Intronic
1130991750 15:88879759-88879781 GTGGGGAGAGGGTTGGGGAAGGG + Intronic
1131066546 15:89438462-89438484 GTGGGCAGACAGATGGGAAGAGG - Intergenic
1131168940 15:90162867-90162889 CTGGGGAGATAAAGGGAGAAAGG - Intronic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131376243 15:91926236-91926258 GTAGGGAGAAAGGTGGAGAGGGG - Intronic
1131433177 15:92402739-92402761 GTGGGGAGGCAGAGGCAGAGCGG - Intronic
1131551225 15:93358713-93358735 GGGGCGAGGCAGATGGAGGAGGG + Intergenic
1132012725 15:98290277-98290299 GATGAGAGACTGATGGAGAATGG + Intergenic
1132302462 15:100784430-100784452 GCGGGGAGCCAGATGGGGAGAGG + Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132701549 16:1224330-1224352 GTGGGGAGAAAGTTCGAGGAGGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133547512 16:6822106-6822128 TGGGGGAGACAGACTGAGAAAGG + Intronic
1133678629 16:8099453-8099475 GTGTGGAGCCAGAAGCAGAAAGG + Intergenic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1135117711 16:19737715-19737737 GGGGAGAGACGGAGGGAGAAAGG - Intronic
1135331373 16:21562897-21562919 GGGGGGAGAAAGAGAGAGAAAGG - Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136102052 16:28003733-28003755 GTGGGGATTGAGATGGAGACAGG - Intronic
1136455764 16:30378841-30378863 GTGGGGAGAGAGGGGGAGAGAGG + Intronic
1136553946 16:30997071-30997093 GTGGGGGGACAGACGGATCAGGG + Intronic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138074835 16:54031878-54031900 ATGGGCAGACAGATGGAAAGAGG + Intronic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138441123 16:57035574-57035596 GTTGGGGGAGAGATGGAGGAAGG - Intronic
1138532283 16:57640931-57640953 GTGGGAACACAGATAGGGAAGGG + Intronic
1138883183 16:61041730-61041752 GTGGGGAGAAAGATGTAGGCTGG - Intergenic
1139313068 16:66043305-66043327 TTGGTCAGAGAGATGGAGAAAGG + Intergenic
1140315660 16:73894317-73894339 ATGGGGAGAGAGAGGGAGAGAGG + Intergenic
1140528762 16:75646612-75646634 TTGGGGAAAGCGATGGAGAAGGG + Intronic
1141048837 16:80742584-80742606 GTGGGTAGATAGGTGGAGGATGG + Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1141860036 16:86710373-86710395 GTGGGGAGGCACAGGCAGAAAGG - Intergenic
1142608893 17:1096985-1097007 GGGAGGAGACAGCTGGGGAAGGG + Intronic
1142897958 17:2994447-2994469 GTGAGGAGACAGCCAGAGAAGGG + Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143473928 17:7192456-7192478 GGAGTGAGGCAGATGGAGAAAGG + Intronic
1143592548 17:7894346-7894368 ATGGAGAGAGAGAGGGAGAAGGG - Intronic
1143665771 17:8358726-8358748 GTGTGGAGAGAGAGAGAGAAGGG - Intergenic
1144115950 17:12090646-12090668 GTGGGAAGAGACAGGGAGAAGGG - Intronic
1144463675 17:15479309-15479331 GTGAGGAGACACAGGAAGAAGGG + Intronic
1144464477 17:15486047-15486069 GTGTGGAGATAAATGGAGATGGG - Intronic
1144577000 17:16435676-16435698 GTCAGGAAAGAGATGGAGAAAGG - Intronic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1144877681 17:18410982-18411004 TTGGGGAAAGAGATGGAGAGGGG - Intergenic
1144909409 17:18668694-18668716 GTGGGGAGCGAGATGGAAAAGGG - Intronic
1145118694 17:20236097-20236119 GTGGCAAGACAGCTGGAAAAGGG - Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145154550 17:20533421-20533443 TTGGGGAAAGAGATGGAGAGGGG + Intergenic
1145416626 17:22718679-22718701 GTTGGGAGGCAGCTGGAAAAAGG - Intergenic
1145717021 17:27033140-27033162 GTGGGGAGACAGAGAGGGAGAGG - Intergenic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1145960326 17:28883384-28883406 GTGGGGAGACAGCAGCACAAGGG + Intronic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147210288 17:38869433-38869455 GTGGTGTAACAGAAGGAGAAAGG + Intergenic
1147383902 17:40070887-40070909 GAGGGGAGACAAAGAGAGAAAGG - Intronic
1147428396 17:40357029-40357051 GTGGTCAGGCAGAGGGAGAAAGG - Intronic
1147609251 17:41792060-41792082 GTGGGGAGATAGAGGCAGCATGG + Intergenic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1148617938 17:49014249-49014271 AGGGGGAGACAGATGGGGACGGG - Intronic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1148997146 17:51720757-51720779 GTGGAGAGAGGGAAGGAGAAAGG + Intronic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149429793 17:56588566-56588588 GTGCGGAGCCAGATGGGGAGGGG + Intergenic
1149456374 17:56791874-56791896 GGGGGGAGAGAGAGAGAGAAAGG + Intergenic
1150466864 17:65400962-65400984 GGAGGGAGACAGATGAAGAGAGG - Intergenic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1151607371 17:75147068-75147090 GTGGGGAGAGAACTGGAGAAGGG - Intronic
1151658968 17:75508663-75508685 GTGGGGAGAGAGAAGGAAAGAGG + Intronic
1151676693 17:75602476-75602498 GTGGGGAGGGAAGTGGAGAAAGG - Intergenic
1151712298 17:75813725-75813747 GGGTGGGGTCAGATGGAGAAAGG - Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151986432 17:77546989-77547011 GTGGGGCGGCAGCTGGAGAGTGG + Intergenic
1152588166 17:81198308-81198330 GCAGGGAGACAGATGCAGCAAGG + Intronic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1153226418 18:2903415-2903437 GTGGGAAGAAGGATGGGGAAGGG - Intronic
1155230072 18:23764221-23764243 GGGGGGAGACAAATGAAGAATGG - Intronic
1155444548 18:25897415-25897437 GGGGGGAGAAAGATGGAGGTGGG - Intergenic
1155701368 18:28748043-28748065 GTGGGGAGACAGCAAGAAAATGG + Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155820264 18:30366116-30366138 GAGAGGGGACAGATTGAGAAGGG - Intergenic
1155862325 18:30918855-30918877 GTAGCCAGAGAGATGGAGAATGG + Intergenic
1156625518 18:38902978-38903000 GAGGGGAGACAAATGGAAACAGG - Intergenic
1157203801 18:45681642-45681664 GTGAGCAGAGAGATGGAGAGAGG - Intronic
1157279071 18:46334100-46334122 GCGGGGAGACAGATGGCCCATGG - Intronic
1157453146 18:47802788-47802810 GAGGGAAGACAGTTGGAGAAAGG + Intergenic
1157650675 18:49327038-49327060 GTGGGGGGAGAGAAAGAGAAAGG + Intronic
1157855224 18:51099268-51099290 GTGAGAAGACATATGGAGTAGGG - Intergenic
1157993489 18:52526282-52526304 GGGAGGAGACAGATGGCCAATGG + Intronic
1159024409 18:63169445-63169467 GGAGGGAGAGAGAGGGAGAAAGG - Intronic
1159271677 18:66161050-66161072 GTGGGGAGACAGAGAGAGAGAGG - Intergenic
1159780220 18:72652346-72652368 GTGAGGAGAAAAATGGAGAGAGG - Intergenic
1160172568 18:76567249-76567271 GTGGGGAGAGAGACAGAGAGAGG - Intergenic
1160251257 18:77205157-77205179 GGGGAGAGACAGAGGGAGAGAGG - Intergenic
1160459331 18:79026183-79026205 GTGGGGAGACAAAAGCAGACAGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1161256186 19:3311086-3311108 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161256200 19:3311208-3311230 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161257919 19:3320155-3320177 GGAGGGAGAGAGAGGGAGAAGGG + Intergenic
1161258563 19:3323091-3323113 GTGGATAGATAGATGGATAAAGG + Intergenic
1161329376 19:3678930-3678952 GTGGAGGGAGGGATGGAGAATGG + Intronic
1161427276 19:4210459-4210481 GGAGGGAGAGAGATGGAGGAGGG - Intronic
1161432805 19:4243576-4243598 GTGGGGAGAGAGAGAGAGAGAGG - Intergenic
1162123703 19:8487813-8487835 GTGGGGAAAGAGGTGAAGAATGG - Intronic
1162526409 19:11209265-11209287 GTGGGGAGATAGATGAGGGATGG - Intronic
1162575230 19:11495299-11495321 GTGGGGAGGGAGGAGGAGAAAGG + Intronic
1162622924 19:11858839-11858861 GTGGGCAAACAGATAGAAAAGGG - Intronic
1162777252 19:12987372-12987394 GAGGGGAGAGGGAAGGAGAAGGG + Intergenic
1163041967 19:14609351-14609373 GAGGGAAGCTAGATGGAGAAGGG - Intronic
1164410527 19:28001094-28001116 GTGGTGATAGAGATGGAGAGAGG + Intergenic
1164433713 19:28209915-28209937 GTGGGGAGACAGAGAGACAGAGG - Intergenic
1164479823 19:28602718-28602740 GTGGGAAGTCAAAGGGAGAATGG + Intergenic
1164693003 19:30224940-30224962 GAGGAGAGAGAGACGGAGAAGGG - Intergenic
1164997278 19:32731136-32731158 GGGAGGAGAGAAATGGAGAAGGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165745571 19:38228379-38228401 GTGGGGGGAGAGAGGGAGAGAGG - Intronic
1166106276 19:40599636-40599658 GGGGGGAGAGAGAGGGAGAGGGG - Intronic
1166694911 19:44846805-44846827 GTGGTGAGAGAGATGCAGAAAGG - Intronic
1166776459 19:45315770-45315792 GAGGGGAGAGAGACAGAGAAGGG - Intronic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1167110602 19:47458405-47458427 CGGGGGAGAGAGATGGGGAAAGG - Intronic
1167110633 19:47458585-47458607 GGGGGGAGAGAGATGGGGAGAGG - Intronic
1167240851 19:48342245-48342267 GGGAGGAGAGAGAGGGAGAAAGG + Intronic
1167642871 19:50691430-50691452 GGAGGGAGAAAGATGGAGGAAGG - Intronic
1167676452 19:50889386-50889408 GAGGAGAGACAAATGGCGAAAGG + Intergenic
1167689860 19:50978631-50978653 GTGGGGAGAGAGATGGGGTGGGG + Intronic
1168284130 19:55322049-55322071 GTTGGGAGAGAGAAGGAAAAGGG - Intronic
1168530480 19:57124371-57124393 GTGGGGAGAGAGACAGAGAAAGG - Intronic
1168721618 19:58557753-58557775 TTGGGGTGACAGGTGGAGGAGGG - Intronic
925321822 2:2976227-2976249 GTGGGAAAAGAGATGGGGAAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926043052 2:9690235-9690257 GTGGGGAGGCAGTGTGAGAAGGG + Intergenic
926363491 2:12112107-12112129 GTGGGGAAAAAGTTGGAGATGGG + Intergenic
926853577 2:17227787-17227809 GTGGTGAGAGTGATGGAGAACGG - Intergenic
927019181 2:18999543-18999565 GTAGGGAGAGAGAGAGAGAAGGG - Intergenic
927029706 2:19108019-19108041 GTGGGGAGAAAGAGAGAGAGAGG + Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927705851 2:25296210-25296232 CTTTGGAGACAGTTGGAGAAGGG + Intronic
928227172 2:29460699-29460721 ATAGGGAGAAAAATGGAGAATGG - Intronic
928718917 2:34096742-34096764 GGGAGGAGAAAGATAGAGAATGG + Intergenic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
929574187 2:43041865-43041887 GTGGGGAGGCTGATGGGGAGAGG + Intergenic
929617777 2:43325624-43325646 GGAGGAAGACAGAGGGAGAAAGG + Intronic
929773899 2:44915817-44915839 GTGGGGAGAGGGAGGGAGAGAGG + Intergenic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
929936778 2:46298896-46298918 GGGTGGAGACAGGAGGAGAAAGG - Intronic
930044792 2:47160036-47160058 GTGGGGAAGCATATGGAGATGGG - Intronic
930164878 2:48195027-48195049 GTCAGGAGTCAGATGGAGAAGGG - Intergenic
930891094 2:56389015-56389037 TTGGGGAGAAAGTGGGAGAAGGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931787327 2:65631810-65631832 GAGGCGAAAAAGATGGAGAAGGG - Intergenic
932080393 2:68709249-68709271 GTAGGGAAAGAAATGGAGAACGG - Intronic
932277227 2:70460685-70460707 GTGGGGAGAGGGCTGGAGTATGG + Intronic
932445760 2:71780068-71780090 GTGGAGAGAGAGAGAGAGAATGG - Intergenic
932568326 2:72923539-72923561 GGGGAGAGAGAGGTGGAGAAAGG + Intronic
932722528 2:74148128-74148150 CTGGGGAGACTGAAGGAGAGCGG - Intergenic
932824247 2:74925388-74925410 GGGGGGACACAGTTGGAAAAAGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933247624 2:79993739-79993761 TTGGGGAGACAGATGGGCATGGG + Intronic
933335251 2:80949894-80949916 GTAGGGAAACAGATTGAGAAAGG - Intergenic
933577880 2:84090433-84090455 GTGGGGGGAGAGAGGGAGAGTGG - Intergenic
934060370 2:88286793-88286815 GTAGGGAGAAAGAGGGAGAGGGG - Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934704659 2:96468531-96468553 GTGGGGAGAAGGAAGGGGAATGG - Intergenic
934987712 2:98899816-98899838 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987729 2:98899877-98899899 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987736 2:98899908-98899930 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987743 2:98899939-98899961 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987749 2:98899970-98899992 GAGGGGACACAGATGGACAGAGG + Intronic
934987764 2:98900032-98900054 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987771 2:98900063-98900085 GAGGGGAGGCAGATGGACAGAGG + Intronic
934987778 2:98900094-98900116 GAGGGGAGGCAGATGGACAGAGG + Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935525768 2:104164668-104164690 GTGTGAAGACAGAGGAAGAAAGG - Intergenic
935585600 2:104797261-104797283 ATGGGGAGGCAAATGGAAAACGG + Intergenic
935618202 2:105107121-105107143 GTGGGGAGGCAGAAGGAGCGAGG - Intergenic
936105862 2:109623850-109623872 GTGGGGAGAGGAAAGGAGAAGGG + Intergenic
936543634 2:113372145-113372167 GAGGGAAGACAGCTGCAGAAAGG + Intergenic
937021126 2:118656826-118656848 GTGGGGATATAAATGGTGAAGGG + Intergenic
937287294 2:120761589-120761611 GTGTGGAGGCAGAGGCAGAAGGG + Intronic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
938106038 2:128530423-128530445 GTGGTGAGACAGGAAGAGAAGGG - Intergenic
939290789 2:140192339-140192361 GTGTGGAGAAAAAGGGAGAAAGG + Intergenic
939476036 2:142687214-142687236 GGAGGGAGACAGAGAGAGAAGGG + Intergenic
939576445 2:143900965-143900987 GTGAGGAGACCGGGGGAGAAAGG + Intergenic
940015085 2:149095803-149095825 GATGGGAGACAGAGGGAGATAGG + Intronic
940037470 2:149325894-149325916 GAGGAAAGAGAGATGGAGAATGG + Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941347701 2:164390405-164390427 GTGGGGCGAGAGATTGAGGAAGG - Intergenic
941987953 2:171526414-171526436 GAGGGGAGAGAGAGGGGGAAAGG - Intronic
941987961 2:171526436-171526458 GTGGGGAGAGAGAGGGGGAAAGG - Intronic
943787602 2:191895792-191895814 GAGGGGAGACAAATAAAGAAGGG - Intergenic
944103878 2:196058449-196058471 GTGGAGAGACACATGGGGATAGG - Intronic
944193080 2:197024031-197024053 GTGGGGAGACAGGCAGTGAAAGG + Intronic
944472927 2:200074269-200074291 GTAGGTAGAAAGACGGAGAAAGG - Intergenic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
945554543 2:211262671-211262693 GAGGGTAGAGACATGGAGAAGGG - Intergenic
946043656 2:216803592-216803614 GTCGGGACACAGCTGTAGAAAGG - Intergenic
946201025 2:218070876-218070898 CTGGGGAGAGGGATGGGGAAGGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946276085 2:218632912-218632934 GAAGGGAGGCAGAGGGAGAAGGG + Intronic
946335819 2:219035826-219035848 GTCTGGAGACAGATGGTGAGAGG + Intronic
947139148 2:227004857-227004879 GTGGGGAGGCAGGGAGAGAAGGG + Exonic
947342220 2:229152086-229152108 GTGGGGAGTGGGATGGAAAATGG - Intronic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
948010419 2:234646910-234646932 GTAGGGAGACAGTGGGAGTAGGG - Intergenic
948010941 2:234648994-234649016 GTAGGGAGACAGTGGGAGTAGGG - Intergenic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
948673574 2:239584100-239584122 GAGGGAAGTCAGTTGGAGAATGG + Exonic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168881478 20:1209748-1209770 GAGGGGACAGAGATGGAAAAAGG + Intergenic
1169303515 20:4468196-4468218 TTGGAGTGAAAGATGGAGAAAGG + Intergenic
1169636428 20:7697103-7697125 GTAGGGAGAAAGAGGGAGAGAGG - Intergenic
1170396586 20:15932210-15932232 GGAGGGAGACACATGGAGAGAGG - Intronic
1170785275 20:19462247-19462269 GTGGGGAGGCAGATGGCGGGTGG + Intronic
1170898014 20:20434016-20434038 GTAGGGAGGAAGAGGGAGAAGGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171021664 20:21589723-21589745 GTGGGAGGGGAGATGGAGAAAGG - Intergenic
1171145734 20:22780535-22780557 GTGGGGAGAGAGAAGCAGCATGG - Intergenic
1171236689 20:23532782-23532804 GAGAGGAGAGAGATGGGGAATGG + Intergenic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1171519946 20:25768066-25768088 GTTGGGAGGCAGCTGGAAAAAGG - Intronic
1171556973 20:26088427-26088449 GTTGGGAGGCAGCTGGAAAAAGG + Intergenic
1172022750 20:31925839-31925861 GTGGGAAGAGAGAGAGAGAAGGG - Intronic
1172229985 20:33330130-33330152 GTGGGGAGTCACATGCAGGATGG - Intergenic
1172292181 20:33784246-33784268 GGGGGGAGAGAGATGGAGAGAGG - Intronic
1172475279 20:35232599-35232621 GGGAGGAGAATGATGGAGAAGGG + Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173602571 20:44306592-44306614 GAGGGGGGACAGAAGGACAATGG - Exonic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1173944639 20:46940933-46940955 GTGGCGAGACAGATGGAGTCAGG - Intronic
1174289268 20:49496212-49496234 GTGGAAAGACAGATGGTGTACGG - Intergenic
1174932753 20:54833436-54833458 GGGGGGAGACAGAGAGAGAGAGG - Intergenic
1175220676 20:57414761-57414783 GTGGGGAGACTGAAGCAGGAGGG - Intergenic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175515874 20:59569436-59569458 GTGGGGAGAGAGAGAGAGAATGG + Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175791762 20:61744461-61744483 GGAGGGAGAGAGATGGAGAGAGG + Intronic
1175791779 20:61744538-61744560 GGAGGGAGAGAGATGGAGAGAGG + Intronic
1175921395 20:62452000-62452022 GGGGGGAGAGAGATGGGGGAGGG + Intergenic
1175921420 20:62452096-62452118 GCGGGGAGAGAGAGGGAGAAGGG + Intergenic
1175967255 20:62665837-62665859 GTGAGGGGACAGGTGGAGAGGGG - Intronic
1176051272 20:63120845-63120867 TTGGGGAGGAGGATGGAGAATGG - Intergenic
1176587390 21:8601326-8601348 CATGGGAGACAGATGTAGAATGG + Intergenic
1176654076 21:9574349-9574371 GTTGGGAGGCAGCTGGAAAAAGG - Intergenic
1176718101 21:10371530-10371552 GTGGAGAGAGAGAGAGAGAAAGG - Intergenic
1176960049 21:15149265-15149287 GTTGGGGGACAGAGGCAGAAGGG - Intergenic
1177135857 21:17304833-17304855 GTGGGGAGGCAGATAGATATAGG - Intergenic
1177675546 21:24294280-24294302 GTGGGGAGAGAGAGAGAGAGAGG - Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178396623 21:32248934-32248956 CTGGGGAGAAAAATGAAGAAAGG + Intergenic
1178925776 21:36773703-36773725 GTGGCGAGGAAGAGGGAGAAGGG + Intronic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180270221 22:10578323-10578345 CATGGGAGACAGATGTAGAATGG + Intergenic
1180299329 22:11024440-11024462 GTGGAGAGAGAGAGAGAGAAAGG - Intergenic
1180748920 22:18111136-18111158 CTGGGGAGCCCGACGGAGAAGGG + Intronic
1181310049 22:21939739-21939761 GTGGGCTGACAGTTGGGGAAGGG - Intronic
1181537103 22:23552068-23552090 ATGGGAAGATAAATGGAGAATGG - Intergenic
1182048972 22:27298872-27298894 GAGGGGAGAGAAATGGAGAATGG + Intergenic
1182057485 22:27371217-27371239 CTGGGGAGTCAGACGCAGAAGGG + Intergenic
1182331250 22:29552848-29552870 GTGTGGAGAGAGGTGGACAAGGG + Intronic
1182332276 22:29559678-29559700 GTGGGGCAAGAGAAGGAGAAGGG - Intronic
1182458954 22:30470813-30470835 GTGGGTAGGTAGATGGAAAAAGG + Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1183075049 22:35421611-35421633 GTGGGGAGAAAGGAGGAGAGGGG - Intronic
1183274723 22:36886650-36886672 GTGGAGAAAGAGGTGGAGAAAGG - Intergenic
1183291366 22:37003790-37003812 GTTGGAAGACAGAAGGAAAAAGG - Intronic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1183551005 22:38485303-38485325 GTGGGGAGGCAGAGTGTGAAGGG + Exonic
1183714313 22:39524756-39524778 CTTGGCAGACAGATGGAGAGAGG - Intergenic
1184111010 22:42395078-42395100 GTGGGAAGATAGCTGGAGACCGG + Intronic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184769682 22:46589903-46589925 GTAGGGAGAAAGCTGCAGAAAGG - Intronic
1184942011 22:47775472-47775494 GTGGGGAGTGGGATGGAGACAGG + Intergenic
1185030593 22:48440985-48441007 GTGAGGAGACAGCTGCAGGATGG - Intergenic
1185102623 22:48849826-48849848 GTGGGGACAGAAAGGGAGAAAGG + Intronic
949682191 3:6526969-6526991 GTGGAGAGAAAGAGGAAGAAGGG + Intergenic
949788416 3:7766740-7766762 GAGGGGAGAAAGAGGAAGAAAGG + Intergenic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950358924 3:12436790-12436812 GGGGAGAGAAAGAGGGAGAAAGG - Intergenic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950491087 3:13305491-13305513 GTGGGGTGACAGATGTAGTTCGG + Intergenic
950521484 3:13500392-13500414 GTGGGGAGCCACATGGAGCCAGG + Intronic
951739606 3:25905914-25905936 CTGGGCAGTCTGATGGAGAATGG + Intergenic
951953712 3:28230311-28230333 GTGGGCAGTCAGATGAGGAATGG - Intergenic
952576353 3:34778705-34778727 GTGGGGAAATAAATGGAGAAAGG + Intergenic
953807957 3:46087922-46087944 ATTGGGAGAGTGATGGAGAAAGG - Intergenic
953862925 3:46560798-46560820 ATGATGAGACAGAAGGAGAACGG + Intronic
954389815 3:50262811-50262833 GTTGGAAGACGGATGGAGAAAGG - Intergenic
954413371 3:50380932-50380954 GTGGGCTGGTAGATGGAGAAAGG + Intronic
954582164 3:51708764-51708786 GTGGGGAGGCAGAGTCAGAAGGG + Intronic
954638693 3:52085380-52085402 GTGAGGAGGCAGAGGGTGAAGGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954838296 3:53490490-53490512 GTGGGAGGAAAAATGGAGAATGG + Intergenic
955348267 3:58176633-58176655 GTGGGGAGGCTGAGGCAGAAGGG + Intergenic
955543988 3:60007900-60007922 GAGGGTAGACAAATGGAAAAAGG + Intronic
956568933 3:70672488-70672510 GTGGGGAGTAAGATAGAAAAAGG + Intergenic
956901589 3:73721969-73721991 GTGTGGAGAAAAATGGAGATTGG + Intergenic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957473776 3:80697261-80697283 GTAGTAAGACATATGGAGAAAGG - Intergenic
958421798 3:93938954-93938976 GAGGGTAGAGACATGGAGAAGGG - Intronic
958927583 3:100175902-100175924 GTGGGGAGAAAGATGAGGACAGG - Intronic
959382595 3:105659501-105659523 GTGGTCAGAGAGATAGAGAAAGG + Intronic
959650234 3:108744225-108744247 GTTGGGAGGCAGAGGGAGAAAGG - Intronic
960165924 3:114401155-114401177 GGGAGGAGACAGAAGGAGAAAGG + Intronic
960180479 3:114569862-114569884 GTGGGGAGAGAGAGAGAGAATGG - Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
960810666 3:121624474-121624496 GGGTGGAGAAGGATGGAGAATGG - Intronic
960924596 3:122781558-122781580 GTGGGGAGACGGAGAGAGAGAGG + Intronic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
962066654 3:131988427-131988449 GTGGTGAGCCAGTTGGAGAGCGG + Intronic
962201510 3:133404289-133404311 GTAGGGAGACAGAGGGAGGTAGG - Intronic
962850595 3:139305903-139305925 GTGGGGAGAAAGAGAGAGAGAGG - Intronic
962855584 3:139341824-139341846 GTACGGAGAGAGATGGAGAAAGG - Intronic
962935050 3:140073253-140073275 GTGGGAAGAAAGAAGGAGAGAGG + Intronic
963203981 3:142614088-142614110 GTGAGGAGAGAGATGGTAAAGGG - Intronic
963520286 3:146354753-146354775 GAGGGTAGAGACATGGAGAAGGG - Intergenic
963645821 3:147912801-147912823 GTGGGGAGAGGGGTGGGGAAAGG + Intergenic
964527904 3:157634811-157634833 GTTGGGAGACAGCTGGCAAATGG + Intronic
965166179 3:165196247-165196269 GTGGGGGGAAAGAAGGAGAGGGG + Intronic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966498678 3:180611653-180611675 TTTGGGAGACAGATAGAGATAGG + Intronic
967461812 3:189756715-189756737 GGGAGGAGACAGAAGGAAAAGGG - Intronic
967577330 3:191108817-191108839 ATGGGGAGAAAGAGAGAGAAGGG - Intergenic
967776226 3:193388810-193388832 GTGGTTACAAAGATGGAGAATGG + Intergenic
968037856 3:195563453-195563475 ATGGGGAGACAGAGGGCAAAAGG - Intergenic
968647853 4:1749120-1749142 GTGGGGGGACAGGTGGGGAGGGG - Intergenic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969363781 4:6682062-6682084 GTGGGGAGAGATATTCAGAAAGG - Intergenic
969500685 4:7550857-7550879 CGGGTGAGACAGATGGAAAAAGG - Intronic
969504641 4:7577278-7577300 GTGGGGAGACAGGTGAAGGCAGG + Intronic
969607812 4:8211234-8211256 GTGGGGAGAGGGAGGGAGAGGGG - Intronic
969890886 4:10258995-10259017 GTGGGCAGACAGGTGGAGGCTGG + Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
971001900 4:22332701-22332723 GAGGGGATACAGTTGGGGAAGGG - Intergenic
971597493 4:28549560-28549582 GTGGGGAGAGAGGTGGAGTCCGG + Intergenic
972664324 4:41149477-41149499 GGGGGGAGAAAGAAGGAGAAGGG + Intronic
972888046 4:43517428-43517450 GTGGCGAGAGAGAGAGAGAAGGG + Intergenic
973290934 4:48469727-48469749 GGGGGGAGAGAGAAGGAGATGGG + Intergenic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
973587119 4:52404565-52404587 ATGGGGAGACAGATGTTCAAGGG - Intergenic
973745798 4:53962356-53962378 AAGGGGAGAAGGATGGAGAAAGG + Intronic
973781893 4:54295506-54295528 GTTTGGAGATAGATGGATAAGGG + Exonic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
975902093 4:79165213-79165235 ATGGGGATAATGATGGAGAATGG + Intergenic
976210907 4:82668818-82668840 TTGGGGAGAGACATGGAGACAGG - Intronic
976614925 4:87066614-87066636 GTAGGGAGAGACAAGGAGAAGGG + Intronic
976615225 4:87069426-87069448 ATAGGGAGAGAGAGGGAGAAGGG - Intronic
977026400 4:91823612-91823634 CTTGGGAGAAAGATGGAGACTGG + Intergenic
977242546 4:94590679-94590701 GTGGGGAGACAAGTGTGGAAAGG + Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977385584 4:96335260-96335282 GTTGGCAAAGAGATGGAGAAAGG - Intergenic
978303390 4:107294964-107294986 GAGGGTAGAGACATGGAGAAGGG + Intergenic
978533743 4:109739490-109739512 GTGGTGTGACAGAGGGAGACTGG + Intergenic
978553279 4:109950742-109950764 GAGGAGAGACAGCTGGTGAAGGG - Intronic
979017654 4:115454571-115454593 ATGGGGAGACAGAGAGAAAAGGG + Intergenic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
980015101 4:127641012-127641034 GTGGGGAGAGAGAGAGAGAGAGG - Intronic
980244188 4:130217354-130217376 GTGGGGAGAGTGATAAAGAAAGG - Intergenic
980394475 4:132192533-132192555 GTGGGGAGGCAGATGAAGTAGGG + Intergenic
980568833 4:134583103-134583125 GGGGAGAGAGAGATGGAGAGAGG - Intergenic
981172908 4:141645557-141645579 GTGGGAAGACACCTGGAGAGAGG - Intronic
983004110 4:162461322-162461344 GTGAGTAGAAAGATGGAAAAGGG + Intergenic
983358062 4:166690487-166690509 GTGGGGAAACAGATGTGGATGGG + Intergenic
983897056 4:173092433-173092455 GTGGGAAAAGAGCTGGAGAATGG + Intergenic
984599043 4:181705108-181705130 GTGGGTAGAGGGATGGGGAATGG + Intergenic
984686329 4:182672460-182672482 GTTGGCAGAGAGATAGAGAAGGG - Intronic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985083406 4:186289346-186289368 GAGGGGAGGCTGATGGAGATAGG + Intergenic
985674075 5:1221339-1221361 GTGGGGAGAGGAATGGGGAAGGG + Intronic
986135135 5:4969786-4969808 ATGGGGGGAGAGATAGAGAAAGG + Intergenic
986197470 5:5551303-5551325 GTCAGGAGAGAGAGGGAGAAGGG + Intergenic
986503275 5:8424256-8424278 GTGGGGAGAGAGCGGGAGATGGG - Intergenic
987370632 5:17189501-17189523 GTGGGACGACAGAGGGAGAGAGG - Intronic
987398463 5:17449140-17449162 GTGGGGAGAGAGGTGGAGGTTGG - Intergenic
989419445 5:41219340-41219362 GTGGGGAGACTGAGAAAGAAAGG + Intronic
989652844 5:43712840-43712862 GGTGGGACACAGATTGAGAAAGG + Intergenic
989698139 5:44228440-44228462 GAGTGGAGACAGTTGGAAAAGGG + Intergenic
990517334 5:56542414-56542436 GTGGGGAGACTGGAGGAGACAGG + Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
991389396 5:66125993-66126015 AAGAGGAGACAGCTGGAGAAGGG + Intergenic
991634179 5:68686797-68686819 GTGGGGAGGGGGATGCAGAAGGG + Intergenic
992573977 5:78092112-78092134 GTGGGTAGATAGATGTACAAAGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992999114 5:82362800-82362822 GTGGGGAGACTGCTGGGGAGGGG + Intronic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994714666 5:103307115-103307137 GAAGGGAGACAGATAGAAAAAGG + Intergenic
995259383 5:110084046-110084068 GTGGAGAGCAGGATGGAGAATGG - Intergenic
995349384 5:111157517-111157539 GTAGGGAGGCAGATGGAGCCTGG - Intergenic
996560741 5:124826276-124826298 GTGATGAGAGAGATGGAGTATGG + Intergenic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
997235820 5:132271482-132271504 GTGGGAAGGCAGATGGGGACAGG - Intronic
997657278 5:135564635-135564657 ATGGGCAGACACATGGAGAGAGG + Intergenic
998251553 5:140557107-140557129 GCTCGGAGACAGACGGAGAATGG - Intronic
998449171 5:142220989-142221011 GTGGGGAGCCAGAGGGAGAGGGG + Intergenic
998481893 5:142469805-142469827 GTGAGGAGACAGCAGGAGAGAGG - Intergenic
998667807 5:144318114-144318136 TTGAGGAGACTGAAGGAGAAGGG + Intronic
999924349 5:156358896-156358918 GTGGGGAGACAGGTGGGAGAGGG + Intronic
999945638 5:156592320-156592342 GTGAGGAGGGAGATTGAGAATGG - Intronic
1000917564 5:167100601-167100623 GTGGCAAGAAAGATGGAAAAGGG - Intergenic
1000989159 5:167894438-167894460 GTGGGGAGAGAAAAGGAGAATGG - Intronic
1001020487 5:168178451-168178473 GTGGGGAGACAGCTGCAGCCAGG + Intronic
1001285845 5:170423423-170423445 TTGGGGAGACAAATGGAGAGAGG - Intronic
1001851615 5:174972515-174972537 GTGGGAAGACAAGTGGAGAAGGG - Intergenic
1002448866 5:179307831-179307853 GTGTGGAGTGTGATGGAGAAGGG - Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002867490 6:1135125-1135147 GAGAAGAGACAGCTGGAGAATGG - Intergenic
1002917171 6:1538659-1538681 AGGGGAAGAAAGATGGAGAAGGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003640047 6:7868863-7868885 GTGGGGAGGGAGAGGGAGAGAGG - Intronic
1004247803 6:13996781-13996803 GTGAGGAGACAGTTGGGGTAGGG - Intergenic
1004764736 6:18713464-18713486 GAGGGGAGACACGAGGAGAAAGG + Intergenic
1004899928 6:20184341-20184363 GAGGGGGGACAGGTGGAGGACGG + Intronic
1005184544 6:23150216-23150238 GTGGGGAGATAGACAGAGAGAGG + Intergenic
1005601130 6:27427227-27427249 GTTCTTAGACAGATGGAGAACGG + Intergenic
1005913124 6:30327613-30327635 GTGGTGAGAGAAATGGGGAAAGG - Intronic
1006011880 6:31049182-31049204 GCTGGGAGACAGAGGGAGACTGG + Intergenic
1006337103 6:33426572-33426594 GGGAAGAGACAGATGGAGAGAGG - Intronic
1006357692 6:33570056-33570078 GTGGAGAGAGAGAAAGAGAAGGG - Intergenic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1006724547 6:36188260-36188282 GAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1007381784 6:41494927-41494949 GGGGGGAGGCAGAGGGGGAAGGG + Intergenic
1007553341 6:42746540-42746562 GTGGTGAGAAAGATGGAGCGGGG + Intergenic
1007626317 6:43248189-43248211 GTGGGGAGCGAAATGGAGCAGGG + Intronic
1007655233 6:43447646-43447668 GGTGGGAGACAGACGGGGAAAGG - Intronic
1007705866 6:43790916-43790938 GTGGAGAGACAGAGAGAGATAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008060072 6:46987752-46987774 GGGGGAAGACAGATGAAGAAAGG - Intergenic
1008272283 6:49504081-49504103 GTGGGGTGACAGAGGGTAAAAGG + Intronic
1008856753 6:56097416-56097438 TTGGGGAGATAGATGGTAAAAGG - Intronic
1009030774 6:58055784-58055806 GTGGACAGAAAGAAGGAGAAGGG + Intergenic
1009206630 6:60810245-60810267 GTGGACAGAAAGAAGGAGAAGGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010257149 6:73771155-73771177 GAGGGGTGGGAGATGGAGAAAGG + Intronic
1010651857 6:78464990-78465012 GTAGGGACACAGAGGGAAAAAGG - Intergenic
1011226385 6:85111985-85112007 GTGGTGTGAGAGTTGGAGAAAGG + Intergenic
1011813979 6:91166723-91166745 ATGAGGAGACAGATGTAAAAAGG - Intergenic
1012096571 6:94970087-94970109 GTGGGGACATAGATGGAGCCGGG + Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013285964 6:108681985-108682007 GTGGGGAGCGAGATGTAAAAGGG + Exonic
1013678817 6:112499680-112499702 GTGGGGAGTTATATGGAGATTGG + Intergenic
1013994767 6:116295267-116295289 GTGGGGAGAGAGCGGGAGAGTGG + Intronic
1014400828 6:120987596-120987618 ATCAGGAGACAGATGGAGCAGGG - Intergenic
1015063357 6:128995642-128995664 GGGGAGAGAGAGAAGGAGAAAGG - Intronic
1015469800 6:133591128-133591150 GTAGTCAGACAGATGGGGAAAGG - Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1016123984 6:140376487-140376509 GGGGGGAGAAAGAAAGAGAAAGG - Intergenic
1016430858 6:143983776-143983798 GTGGGAGGACAGATGGAGAATGG + Intronic
1016727281 6:147387906-147387928 CTGGGGAGACAGCTGAGGAAAGG + Intergenic
1017494020 6:154967395-154967417 GTGGGGAGAGAGAGGGAGAGGGG + Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019328506 7:451451-451473 GAGGGGAGAGAGACGGAGAGAGG - Intergenic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020663788 7:11014043-11014065 AGTGGGATACAGATGGAGAAGGG + Intronic
1020673229 7:11146383-11146405 ATGGGGCAACAGCTGGAGAAGGG - Intronic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1021239573 7:18183533-18183555 GTGGGGGAAAAGATGGAGTAAGG - Intronic
1021636487 7:22699198-22699220 GAAGGGAGAATGATGGAGAATGG + Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022906810 7:34865788-34865810 GTGGGGAGAGAGGTCAAGAAGGG - Intronic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023278579 7:38546875-38546897 GTGTGGAGAAGGGTGGAGAATGG - Intronic
1023519897 7:41039616-41039638 GTGGGAAGAGCGATGGAGAGGGG + Intergenic
1023541244 7:41268816-41268838 GAGGGGAGAAAAATGGAGATGGG + Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023856130 7:44185483-44185505 GAGAGGGGACAGATGGAGAGAGG - Intronic
1023911342 7:44559078-44559100 GTGGGGCAACAGTAGGAGAAGGG - Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024317170 7:48031888-48031910 GTGGGGGGAGAGAAAGAGAATGG + Intergenic
1024920145 7:54546285-54546307 GTGGGGAAGGAGAGGGAGAAAGG + Intronic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025249050 7:57339527-57339549 GTGGGGAGAAAGGGGGAAAATGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1025753392 7:64312441-64312463 GAGGGGAGAGAGTTGGAGAGAGG - Intronic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026243985 7:68602113-68602135 ATGGGGAGAGAGAGGGAGAGGGG - Intergenic
1026494106 7:70887993-70888015 GTGGAGGGACAGATTGGGAAAGG + Intergenic
1026543247 7:71299153-71299175 GCGGGGAGGCAGCTGGAGAAGGG + Intronic
1026575134 7:71565482-71565504 GAGGGATGAAAGATGGAGAAGGG - Intronic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1027232471 7:76280744-76280766 GTGGGGGGAGAGAAGGAGAGAGG - Intronic
1027254728 7:76423969-76423991 GTGTGAAGAGAGGTGGAGAAGGG - Intronic
1027526063 7:79270183-79270205 GTGGGCAGGGAGCTGGAGAATGG - Intronic
1028071863 7:86460575-86460597 GTGGGGAGAGAGTAGGAGGAGGG - Intergenic
1028439023 7:90837761-90837783 GTGGGCAGACAGATTCAGAGGGG + Intronic
1029169455 7:98620416-98620438 GAGGTGGGGCAGATGGAGAAGGG + Intronic
1029453892 7:100657459-100657481 GAAGAGAGACAGATGGAGAAAGG - Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030621291 7:111794074-111794096 GTGGGGACACAGATGCTGGAGGG + Intronic
1030688266 7:112508200-112508222 GTGGGGAGACAAAAAGAGAGGGG + Intergenic
1030739937 7:113096782-113096804 GCAGGGAGAAGGATGGAGAAAGG + Intergenic
1031007827 7:116494817-116494839 GTGGGGGGACAGTTGGAGGTGGG + Intronic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1032205816 7:129864249-129864271 GGGGGGAGACAGAGAAAGAACGG + Intronic
1032854039 7:135819361-135819383 GTGGGGAGACCTAATGAGAATGG - Intergenic
1033478654 7:141716338-141716360 GGGAGGAGAGAGAGGGAGAAGGG - Intronic
1033822230 7:145148450-145148472 GAGGGGAGACAGAGAAAGAAAGG - Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034406115 7:150903471-150903493 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1034613535 7:152394327-152394349 GTGGGGAGTCAGATTGTGCAGGG - Intronic
1035237678 7:157509233-157509255 GAGGGGGGAGAGAAGGAGAAGGG + Intergenic
1035237757 7:157509504-157509526 GTGGGGAGAGCAATGGAGATGGG + Intergenic
1035318814 7:158014890-158014912 GAGGAAAGACAGATGGAGATAGG - Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036197549 8:6733512-6733534 GTTGGGTGACAGAAGCAGAATGG + Intronic
1036749556 8:11435212-11435234 GAAGGGTGACAGGTGGAGAAGGG - Intronic
1036769259 8:11567410-11567432 GGGGGAAGAGAGATGGAGAGAGG + Intergenic
1037992423 8:23330462-23330484 GTGGGAAGACAGCTTGGGAAGGG - Intronic
1038659675 8:29486330-29486352 GAGTGGAGAAGGATGGAGAATGG + Intergenic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1038865915 8:31438782-31438804 GTGGTCAGATAGATGGACAATGG + Intergenic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1039004969 8:33025864-33025886 TTGGGGATTCAGATGGATAAAGG - Intergenic
1039550494 8:38439712-38439734 TTGGAGAGAGAGAAGGAGAAAGG - Intronic
1040918544 8:52589810-52589832 GAGAGAAGAGAGATGGAGAAGGG - Intergenic
1040949146 8:52918601-52918623 GGGGAGAGAGAGATGTAGAAAGG + Intergenic
1041411363 8:57560218-57560240 CTGGGGAGGCTGATGTAGAAGGG - Intergenic
1041488718 8:58408724-58408746 GGGAGGAGACAGATGTAGAATGG - Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042036535 8:64540103-64540125 GTGGGGAGACTGAGGTAGGAGGG + Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042578226 8:70246353-70246375 GTGGGGAAAAAGATGGTGTAAGG + Intronic
1042849788 8:73205196-73205218 GAGGTGAGAAAGATGGGGAAGGG - Intergenic
1043398123 8:79858141-79858163 CTGGGAAGCCAGGTGGAGAATGG - Intergenic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1045365934 8:101476253-101476275 TTGGGGAGTAAGATTGAGAAAGG + Intergenic
1045394619 8:101748510-101748532 GGTGGGAGGCAGATGGAGAAAGG - Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1046828281 8:118715975-118715997 GTGGGGAGTGAGATGAAGGATGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047131593 8:122026693-122026715 GGAGGGAGAGAGACGGAGAAGGG - Intergenic
1047131606 8:122026741-122026763 GGAGGGAGAGAGACGGAGAAGGG - Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047220796 8:122916804-122916826 GTGTGGAGACAGATCTGGAAGGG - Intronic
1047544464 8:125802480-125802502 AGGGGGAGAGAGAAGGAGAAGGG + Intergenic
1048039207 8:130709154-130709176 TCGGGGAGGGAGATGGAGAATGG + Intergenic
1048207229 8:132424832-132424854 TTGGTGAGACACATGGAGAGAGG - Intronic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048467989 8:134683528-134683550 GTGGCCAGACAGCTGGAGGAAGG + Intronic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1048973473 8:139657978-139658000 GTGGGCAGATATATGGACAATGG + Intronic
1049445877 8:142631267-142631289 GTGTGGGGACAGGTGGAGAAGGG - Intergenic
1049446547 8:142634089-142634111 GCGAGGAGCCAGAGGGAGAAGGG + Intergenic
1049691260 8:143960750-143960772 GTGGGGGGAGACAGGGAGAAGGG - Intronic
1049889420 9:54814-54836 GAGGGGAGGGTGATGGAGAATGG - Intergenic
1050182873 9:2939075-2939097 GAGGGGAGACAGAGTGAGAGAGG + Intergenic
1050213092 9:3287048-3287070 AAGGGGAGGCACATGGAGAATGG - Intronic
1050445303 9:5715815-5715837 GTGGGGAGAGAGGTAGGGAAGGG - Intronic
1050699288 9:8319434-8319456 GTAGGCATACAGAGGGAGAATGG + Intronic
1050826065 9:9948020-9948042 GAAGGGAGATAGATGAAGAAAGG + Intronic
1050984286 9:12062318-12062340 ATGGGTAGACAGATGAAGAGAGG - Intergenic
1051166813 9:14271207-14271229 GTGGGGAGGGAGGAGGAGAAGGG - Intronic
1051169176 9:14301575-14301597 GTGGGGGGAGAGAAGGAGAGAGG - Intronic
1051887167 9:21905266-21905288 GTGGTGAGCCAGAAGGGGAATGG + Intronic
1052044583 9:23779307-23779329 GTGGGCAGACAGAGGAACAAAGG + Intronic
1052785756 9:32826686-32826708 GTGGGGAGTCACGGGGAGAAGGG + Intergenic
1053221425 9:36316177-36316199 GGAGAGAGACAGAGGGAGAAAGG + Intergenic
1053280785 9:36818738-36818760 GAGGAGAGACAGCTGGAGAGAGG - Intergenic
1054650218 9:67618917-67618939 GTGGGTGGATAGATGGATAATGG - Intergenic
1054723148 9:68623703-68623725 GTGGTGATAGAGATGGAGAAAGG + Intergenic
1054740797 9:68804060-68804082 GTGGGGGTGAAGATGGAGAATGG + Intronic
1054958969 9:70945847-70945869 GTGGGGAGAGAAGGGGAGAAGGG + Intronic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1055967409 9:81879079-81879101 GTGGGGAGTGGGAGGGAGAATGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056388574 9:86119468-86119490 GTCAGGAGACAGAGGGAGCAAGG + Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1056706505 9:88956460-88956482 GGGGGAAGACAGAGGTAGAAGGG - Intergenic
1057177473 9:93010539-93010561 GGAGGGAGAGAGATGGAGACAGG + Intronic
1057387314 9:94615390-94615412 GGGGGGACTGAGATGGAGAATGG + Intronic
1057720004 9:97524534-97524556 GTGTCGAGACAGAGAGAGAAGGG + Intronic
1057871625 9:98722469-98722491 GTGGGGAAACAGGTGCAGAGAGG - Intergenic
1057896838 9:98916005-98916027 GTGAGGAGCCAGACAGAGAATGG + Intergenic
1057908696 9:99002062-99002084 GAGGGGAGGGGGATGGAGAAGGG - Intronic
1058426928 9:104883362-104883384 GTGTGTAGACCAATGGAGAAAGG - Intronic
1058893959 9:109383935-109383957 GTGGGGAGAATGGTGGAGGAGGG - Intronic
1060016203 9:120088437-120088459 GTAGGGAGGAAGATGGAGAGAGG + Intergenic
1060128831 9:121075422-121075444 GTGGGGAGTGAGCGGGAGAAAGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1061187561 9:129063587-129063609 GTGGGCCGACAGATGGTGACAGG + Exonic
1061238829 9:129357666-129357688 GTGGGGAGACGGAGGGGGAAGGG - Intergenic
1061431548 9:130534411-130534433 GTGGGGAGACTGTTGGGGGAGGG - Intergenic
1061634843 9:131901006-131901028 GAGGGGAGACACAAGGAGAGGGG + Intronic
1061900519 9:133669799-133669821 GTGGGGAGACTGAACCAGAACGG + Intronic
1062158389 9:135066677-135066699 GGGGGGAGACACATGCAGCAGGG + Intergenic
1062158413 9:135066784-135066806 GAGGGGAGACACATGCAGAGTGG + Intergenic
1203617349 Un_KI270749v1:79508-79530 CATGGGAGACAGATGTAGAATGG + Intergenic
1203631798 Un_KI270750v1:77807-77829 GTTGGGAGGCAGCTGGAAAAAGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185708473 X:2282685-2282707 GAGGGGAGAAAGAGGGAGAGAGG + Intronic
1185751157 X:2610407-2610429 GAGGGGAGAGAGAGGGAGAGAGG - Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186174144 X:6907430-6907452 GTGGGGACAGACATGGAGAGCGG - Intergenic
1186369031 X:8927698-8927720 GAGGAGAGAGAGAGGGAGAAAGG - Intergenic
1186500231 X:10044979-10045001 GTGGGGGGATAGAGAGAGAAAGG - Intronic
1186677191 X:11831132-11831154 GTGGGGAGCCAGATTGGGACAGG + Intergenic
1186987666 X:15034254-15034276 GTGTGAGGACAGATGGAGAATGG + Intergenic
1187016913 X:15338290-15338312 GTGGGCAGACAGAAGAAGAGTGG + Intergenic
1187026652 X:15442351-15442373 AGAGGGAGAGAGATGGAGAACGG - Intronic
1187103928 X:16221336-16221358 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1187235700 X:17465017-17465039 CTGGGAAGAAAGATGTAGAACGG + Intronic
1187425796 X:19176361-19176383 GTTGGGAGACAGATGGTGGTGGG - Intergenic
1187492098 X:19761374-19761396 GGGGGGAGAGAGAGGGAGAGAGG + Intronic
1187653904 X:21447524-21447546 ATAGGGATACAGATGTAGAAAGG + Intronic
1188279195 X:28242361-28242383 GTTCAGAGACAGATGTAGAAGGG - Intergenic
1188988857 X:36792498-36792520 GTTGGGAGAGAGATGGAGAAGGG - Intergenic
1189567852 X:42261829-42261851 GTGGGGAGAATGAAGGTGAAAGG - Intergenic
1189748382 X:44193704-44193726 GTGTGTAGACAGAGGGAGAGTGG + Intronic
1190472924 X:50800721-50800743 GACTGGAGCCAGATGGAGAATGG + Intronic
1190643407 X:52502699-52502721 CTAGGGAGACGGATGAAGAATGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192773084 X:74214099-74214121 GTGGGGAAAGAAATGGAGGAAGG + Intergenic
1193505615 X:82338869-82338891 TTGTGGAAATAGATGGAGAAAGG - Intergenic
1193533709 X:82686994-82687016 CTTGGGAGACACATGGAGCAAGG - Intergenic
1194211804 X:91079604-91079626 GTTGGGAGAGAATTGGAGAATGG + Intergenic
1194328227 X:92547512-92547534 GGAGGGAGAGAGAGGGAGAAAGG - Intronic
1194374234 X:93112547-93112569 GTGGGGAGAGATATGGGGGATGG + Intergenic
1195017115 X:100790959-100790981 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1195303348 X:103554476-103554498 ATTGGGAGACAGATGGGAAAAGG - Intergenic
1195343475 X:103926537-103926559 GTGGGGATATGGATGGAGCAGGG + Intronic
1195363493 X:104106782-104106804 GTGGGGAGATGGATGGAGCAGGG - Intronic
1195363536 X:104106969-104106991 GTGGGGATATGGATGGAGCAGGG - Intronic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1195365049 X:104116993-104117015 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365073 X:104117111-104117133 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365093 X:104117191-104117213 GTGGGGATATGGATGGAGCAGGG - Intronic
1195410718 X:104566064-104566086 GAGGGGAGGCAGATTGAGAAAGG - Intergenic
1195559639 X:106268963-106268985 GTGGTCAGACAGATGGGCAATGG + Intergenic
1195562322 X:106297376-106297398 GTGGTCAGACAGATGGGCAATGG - Intergenic
1195756136 X:108200609-108200631 GTGGGGGGAGAGATGGAGAGAGG + Intronic
1195822236 X:108957486-108957508 GTGGGAAGAGAGACAGAGAATGG - Intergenic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1197346948 X:125335723-125335745 GTGGGTAGACTGTTGGAGACAGG + Intergenic
1198000416 X:132429400-132429422 TTGGGGAGAAGGATGGACAAGGG + Intronic
1198007527 X:132512295-132512317 GTTGGGAGAAAGATGAAGAGAGG + Intergenic
1198199682 X:134402978-134403000 AGAGGGAGAGAGATGGAGAATGG - Intronic
1199402827 X:147419885-147419907 GGGGGGAGAGAGAGAGAGAAGGG + Intergenic
1200215351 X:154365819-154365841 GTGAGGAGAGAGATGGAGAGGGG + Intronic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200682259 Y:6226615-6226637 GTGGGGAGAGATATGGGGGATGG + Intergenic
1201383636 Y:13413826-13413848 GTGGGGAGCCAGGTGCAGAGTGG - Intronic
1201592061 Y:15626397-15626419 GTGTCTAGACAGATAGAGAATGG - Intergenic
1201650666 Y:16282339-16282361 GTGAGGAGACAGAAGAAAAATGG - Intergenic
1201691948 Y:16777190-16777212 GTGAGGAGACAGAAGAAAAAGGG - Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic