ID: 1078084521

View in Genome Browser
Species Human (GRCh38)
Location 11:8225683-8225705
Sequence ACTAAAGGCTTCACCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078084521_1078084529 30 Left 1078084521 11:8225683-8225705 CCAGGGTGGGTGAAGCCTTTAGT 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1078084529 11:8225736-8225758 CAGATCCCAGTTCAACCACCAGG 0: 1
1: 0
2: 1
3: 10
4: 141
1078084521_1078084523 -4 Left 1078084521 11:8225683-8225705 CCAGGGTGGGTGAAGCCTTTAGT 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1078084523 11:8225702-8225724 TAGTGAGACCCCAAGATCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078084521 Original CRISPR ACTAAAGGCTTCACCCACCC TGG (reversed) Intronic