ID: 1078085204

View in Genome Browser
Species Human (GRCh38)
Location 11:8229740-8229762
Sequence TGGAGCTTCAAGACCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078085204_1078085210 6 Left 1078085204 11:8229740-8229762 CCAACCCAGGTCTTGAAGCTCCA 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1078085210 11:8229769-8229791 GTGGCCCTGCTCCTAGGATATGG 0: 1
1: 0
2: 1
3: 9
4: 108
1078085204_1078085209 0 Left 1078085204 11:8229740-8229762 CCAACCCAGGTCTTGAAGCTCCA 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1078085209 11:8229763-8229785 GCATCAGTGGCCCTGCTCCTAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1078085204_1078085215 27 Left 1078085204 11:8229740-8229762 CCAACCCAGGTCTTGAAGCTCCA 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1078085215 11:8229790-8229812 GGCTGCCTGCCAGTTTCCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 248
1078085204_1078085214 26 Left 1078085204 11:8229740-8229762 CCAACCCAGGTCTTGAAGCTCCA 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1078085214 11:8229789-8229811 TGGCTGCCTGCCAGTTTCCCTGG 0: 1
1: 0
2: 3
3: 34
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078085204 Original CRISPR TGGAGCTTCAAGACCTGGGT TGG (reversed) Intronic
902246447 1:15124139-15124161 TGGAGCTGAAAGACCTGGTGGGG + Intergenic
902717749 1:18283984-18284006 TGGAGCCTGAAGCCCAGGGTGGG - Intronic
903462122 1:23527419-23527441 TGGATCTTCAAGGCCTGGTCAGG + Intronic
903704403 1:25274566-25274588 TGAGCCTTCAAGACCTGGCTGGG - Intronic
905310267 1:37044118-37044140 TGATGCTTCAGGACCTAGGTGGG - Intergenic
905853495 1:41291312-41291334 TGGCGCATCCAGACCTGGGCTGG - Intergenic
906369535 1:45241054-45241076 TGGAGCTTTAAGACTTGACTAGG - Intronic
906414946 1:45614192-45614214 TGGTGCTTCTAGGCTTGGGTTGG + Intronic
906508949 1:46400372-46400394 TGGAGGTGCAGGACCTGGGCAGG + Intronic
906543638 1:46606667-46606689 TGGAACTTCAGGAGCTGGGCTGG + Intronic
906780476 1:48568639-48568661 TGGAGCTTCAAGTACAGGGAAGG - Intronic
907444288 1:54498179-54498201 TGCTGCTCCAAGTCCTGGGTAGG + Intergenic
913684587 1:121219697-121219719 TGGAGCTTTTAGGCTTGGGTTGG + Intronic
914036424 1:144007313-144007335 TGGAGCTTTTAGGCTTGGGTTGG + Intergenic
914153031 1:145060633-145060655 TGGAGCTTTTAGGCTTGGGTTGG - Intronic
914374018 1:147056429-147056451 TGGAGATTCAAGGCCTGCTTTGG - Intergenic
914807601 1:151002906-151002928 TGGGGCTTCCAGACTTGGGAGGG + Intronic
915570519 1:156743026-156743048 TGGAGCATCAACAGCAGGGTGGG - Intronic
917138299 1:171808933-171808955 AGCATCTTCAAGACCTAGGTAGG - Intronic
920471899 1:206238247-206238269 TGGAGCTTTTAGGCTTGGGTTGG + Intronic
920660646 1:207911389-207911411 TGGAGCTTGAAGAAGTGGGATGG - Exonic
1066429519 10:35337507-35337529 TGGAGCGGCCAGAGCTGGGTGGG + Intronic
1071509657 10:86253584-86253606 TGGAGCTTCAGGGCCTGGCTGGG - Intronic
1072954729 10:99878354-99878376 TGGAGCTTTAGGACCTGGTCAGG + Intronic
1074189451 10:111123295-111123317 TGGAGCTTCCAGTCCTTTGTAGG + Intergenic
1074901884 10:117824130-117824152 TGGTGCTCCATGACCTGGGATGG - Intergenic
1076671052 10:132121284-132121306 TGGAGCCCCATGAGCTGGGTTGG - Intronic
1078085204 11:8229740-8229762 TGGAGCTTCAAGACCTGGGTTGG - Intronic
1078249340 11:9604143-9604165 TGGAGCTTCCAAAACTGGCTAGG - Intergenic
1078968427 11:16375456-16375478 TGAAGTTTCAAGATCTGGATTGG - Intronic
1079987596 11:27215225-27215247 TGCAGCTTCAAGTCAAGGGTGGG - Intergenic
1083965588 11:66042089-66042111 GGGAGCCTCAAGCCCTGGGAGGG + Exonic
1084174639 11:67416881-67416903 TAGGGCTTCAAGACCTACGTGGG + Intronic
1084271905 11:68033481-68033503 TGAAGCTTCCAGCCCTGGGCAGG + Intronic
1087058631 11:93957285-93957307 TTGAGCTTCATGGCCTGGTTTGG + Intergenic
1087529754 11:99364776-99364798 TTGAGCTTCATGACCTTGGCAGG + Intronic
1087769083 11:102187343-102187365 TTAAGCTTCAAGACCTGTTTGGG + Intronic
1090467372 11:126946347-126946369 GGGAGTTGCAAGACCTGGTTTGG + Intronic
1091244460 11:134080400-134080422 GGGAGCTACAAGATTTGGGTGGG - Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094716586 12:33020131-33020153 TGGAGCCACAGGAGCTGGGTTGG - Intergenic
1095978764 12:47958191-47958213 TGGAGCTTTAAGATTTGGCTGGG + Intergenic
1098000840 12:65940706-65940728 TGGAGCTATACAACCTGGGTGGG + Intronic
1100195445 12:92239570-92239592 TGGAGCTTCTAGTCCTTGGTGGG - Intergenic
1103534587 12:121626237-121626259 TGGAGCTTGGACTCCTGGGTCGG - Intergenic
1103736542 12:123064420-123064442 AGGAGCATCAAGACCTGGGCTGG + Intronic
1104365188 12:128170450-128170472 TGGAGCTTCCAGCCCAGGCTTGG - Intergenic
1105534046 13:21247648-21247670 TGGAGCTGGGGGACCTGGGTGGG + Intergenic
1106662462 13:31814401-31814423 TGGAGCTGCAGGAGCTGGGCTGG - Intergenic
1108251378 13:48571280-48571302 TGAAGCTTGAAGGCATGGGTCGG + Intergenic
1108969187 13:56350437-56350459 TAGAGGTTCAAGACCAGGCTGGG + Intergenic
1117336741 14:54762472-54762494 TGGAGCTTGATGGCCAGGGTGGG + Intronic
1118910417 14:70057619-70057641 TGGGTCAGCAAGACCTGGGTAGG + Intronic
1120647312 14:87089440-87089462 TGGAGCCAGAATACCTGGGTTGG - Intergenic
1121081707 14:91114004-91114026 TGCAGCTTTAAGAACTGGGGCGG + Intronic
1121335888 14:93077241-93077263 AGGAGCCTCATGGCCTGGGTCGG + Intronic
1123152807 14:106199209-106199231 TGGAGCTTCCACATCTGGCTTGG + Intergenic
1123805334 15:23865937-23865959 TTGACCTTCAACACCTGGTTTGG + Intergenic
1124208650 15:27744208-27744230 TGGATCTTTAAGACCTGGTGGGG + Intergenic
1126066142 15:44827695-44827717 TGGAGCTGCAGAACATGGGTGGG + Intergenic
1126093694 15:45072869-45072891 TGGAGCTGCAGAACATGGGTGGG - Intronic
1129413065 15:75360425-75360447 GAGAAGTTCAAGACCTGGGTTGG - Intronic
1129656046 15:77526464-77526486 TGGAGCTTTGAGTCCTAGGTGGG + Intergenic
1130038218 15:80380780-80380802 GAGAGCTTCAAGAGGTGGGTGGG - Intronic
1131562534 15:93457002-93457024 GGTAGCTTCAAGACCTGTGCAGG + Intergenic
1132829523 16:1920482-1920504 TGGAATTTCAAGTCCTGAGTAGG - Intergenic
1133757892 16:8776350-8776372 CGGATCTTCAACACCTGGCTGGG + Exonic
1135771338 16:25220585-25220607 TGGAGGTTCATGACCAGGTTAGG - Intronic
1136136936 16:28261987-28262009 TGGCCCTTTAAGACCTGGGAGGG + Intergenic
1136694688 16:32067038-32067060 TGGGTCTGCAGGACCTGGGTAGG + Intergenic
1136795190 16:33010300-33010322 TGGGTCTGCAGGACCTGGGTAGG + Intergenic
1136874726 16:33844082-33844104 TGGGTCTGCAGGACCTGGGTAGG - Intergenic
1136922529 16:34344525-34344547 TGGCCCTTCTAGACCTGAGTGGG - Intergenic
1136982044 16:35067281-35067303 TGGCCCTTCTAGACCTGAGTGGG + Intergenic
1137732384 16:50698248-50698270 AGGAGCTTCAAGCCCTGGCAGGG - Intronic
1138336028 16:56253323-56253345 TGGAGTCAGAAGACCTGGGTTGG + Intronic
1139517817 16:67462155-67462177 TGGAGCCTTCAGGCCTGGGTGGG - Intronic
1140109931 16:71995262-71995284 TGGGGCTTTAAGAGGTGGGTTGG - Intronic
1140469486 16:75206228-75206250 TGGAGCATTAGGACCTGGGTGGG - Intronic
1141972100 16:87491527-87491549 TGCAGGTTGGAGACCTGGGTGGG + Intronic
1142005791 16:87689076-87689098 TGGGGCTTCAAGTCCTAGGGCGG - Intronic
1142056308 16:87998491-87998513 TGGAGCCTCAGGAGCCGGGTCGG - Intronic
1203097443 16_KI270728v1_random:1271960-1271982 TGGGTCTGCAGGACCTGGGTAGG + Intergenic
1143362274 17:6381926-6381948 TGGATCTGCAAGCCCTCGGTAGG - Intergenic
1143406850 17:6683498-6683520 TGGAGTTGGAAGATCTGGGTTGG - Intergenic
1143543965 17:7585665-7585687 AGGAGCTTCAAGCCCTGGCCTGG + Intronic
1144109581 17:12019458-12019480 AGGAGCAACAAGAGCTGGGTGGG + Intergenic
1147381706 17:40060183-40060205 AGCAGCTTCAAGAAATGGGTGGG + Intronic
1152681897 17:81672751-81672773 AGGAGCTGCTACACCTGGGTAGG + Exonic
1152848046 17:82614386-82614408 TGGAGCTTCACTCCCTGTGTCGG - Intronic
1153538423 18:6128753-6128775 TGGAGCTTCTATTCCTGGCTTGG - Intronic
1153819175 18:8818243-8818265 TGGAGTTAGAAGACCTGAGTTGG - Intronic
1156878827 18:42050557-42050579 TAGAGCTTGAACAACTGGGTAGG - Intronic
1158395917 18:57078271-57078293 TGGAGCTTCTAGCCCTGGTGAGG - Intergenic
1159086436 18:63797642-63797664 GTGGGCTTCAAGACCTGGGTAGG - Intronic
1159168357 18:64730766-64730788 TGGAGGTTCAGGACATGGCTAGG + Intergenic
1160443576 18:78911532-78911554 TGGAGCTGGAGGACCTGGGGTGG - Intergenic
1160443606 18:78911615-78911637 TGGAGCTGGAGGACCTGGGGTGG - Intergenic
1161070206 19:2256166-2256188 TGGGGCTCCAAGACCTGGAAGGG + Intronic
1162453792 19:10770184-10770206 TGAAGATTCTAGACCTGGCTGGG + Intronic
1163004194 19:14387305-14387327 TGGAGTTTCAGGAACTGAGTAGG - Intronic
1166587742 19:43965898-43965920 TGGAGTTTTGAGACCTGGTTAGG - Exonic
1167469119 19:49665667-49665689 CGGAGCTCCAAGACAGGGGTGGG - Exonic
1168269022 19:55239714-55239736 TGGAGCCCCCAGACCAGGGTGGG + Intronic
928105437 2:28467831-28467853 TGGAGCTTTCAGCCCTGGGTAGG + Intronic
929801851 2:45111355-45111377 TGGAGCTTGGACACATGGGTTGG - Intergenic
931803009 2:65777133-65777155 GGGACCTTGAAGTCCTGGGTTGG + Intergenic
932021151 2:68088152-68088174 GGCAGCTTCTAGCCCTGGGTGGG + Intronic
933090448 2:78110551-78110573 TTGAGCTACAGCACCTGGGTGGG + Intergenic
933341705 2:81034080-81034102 TGTAGCTGCACTACCTGGGTTGG + Intergenic
933563561 2:83920369-83920391 TTGTGCTTCCAGACCTGGGATGG - Intergenic
936963249 2:118099192-118099214 TGGATTTTCAAGACCTCGCTAGG + Intronic
937401657 2:121589014-121589036 TGGAGCTGCAAGATGTGAGTTGG + Intronic
938997077 2:136691459-136691481 TGGGGCAGCAAGACATGGGTAGG + Intergenic
939125922 2:138177333-138177355 TGGAGTTAAAAGACCTGGGTTGG - Intergenic
946761948 2:223003374-223003396 TGGAGCTGCAAGACTTGGATTGG + Intergenic
1168997819 20:2145925-2145947 TAGAGCTACTAGACCTGGGGAGG - Exonic
1170438094 20:16350710-16350732 TGGAGCATGAGGAGCTGGGTGGG + Intronic
1171966686 20:31536039-31536061 TGGAGCTGCAAGACGTGTGAAGG - Intronic
1172581130 20:36049915-36049937 TGGAGCTGGAAGACCTGAGAAGG - Intergenic
1173591999 20:44231946-44231968 CGCAGCTTCAAGAGCTGGGTGGG + Intergenic
1174188366 20:48722814-48722836 TGGAGCTTCCAGACTTGGGCTGG - Intronic
1174857637 20:54061857-54061879 TGAATCCTCAAGACCAGGGTTGG + Intronic
1175166858 20:57050108-57050130 TGGGGCTTCATGGCCCGGGTCGG + Intergenic
1176103942 20:63376961-63376983 TGGACCTCCCCGACCTGGGTGGG + Intronic
1180076139 21:45464048-45464070 TGGAGCTTTGAGAACTGGGCTGG + Intronic
1180081281 21:45488909-45488931 GGGAGCTTCGGGGCCTGGGTGGG - Intronic
1180233674 21:46443554-46443576 GGGGGTCTCAAGACCTGGGTGGG - Intronic
1180824732 22:18854613-18854635 TGGGGCTTTCAGACCTGGGCGGG + Intronic
1181125150 22:20697764-20697786 TGGGGCTTTCAGACCTGGGCGGG + Intergenic
1181187998 22:21119934-21119956 TGGGGCTTTCAGACCTGGGCGGG - Intergenic
1181211200 22:21290559-21290581 TGGGGCTTTCAGACCTGGGCGGG + Intergenic
1181398304 22:22636329-22636351 TGGGGCTTTCAGACCTGGGCGGG - Intergenic
1181501044 22:23315693-23315715 TGGGGCTCCCAGACCTGGGCGGG - Exonic
1181651110 22:24259731-24259753 TGGGGCTTTCAGACCTGGGCGGG + Intergenic
1181706270 22:24651008-24651030 TGGGGCTTTCAGACCTGGGCGGG - Intergenic
1182884325 22:33760445-33760467 TGGAGCTGTCAGACCTGGGCTGG - Intronic
1203215749 22_KI270731v1_random:4872-4894 TGGGGCTTTCAGACCTGGGCGGG - Intergenic
1203274878 22_KI270734v1_random:80519-80541 TGGGGCTTTCAGACCTGGGCGGG + Intergenic
950202664 3:11056168-11056190 TGGAGCCACAGGGCCTGGGTTGG - Intergenic
951140703 3:19155219-19155241 TGCAGCTTGAAGAACTGGATGGG - Intronic
953702663 3:45208779-45208801 TGGGGTTTCAAGAGCTGGTTGGG + Intergenic
954109872 3:48428014-48428036 AGGAGCTTCAAGTCCAGAGTAGG - Intronic
954371260 3:50170692-50170714 GTGAGCTTCATGACCTGAGTTGG - Intronic
955395430 3:58553961-58553983 TGGAGCTTTAAGATTTGGCTGGG - Intergenic
956716589 3:72085334-72085356 AGGAGCTGCCACACCTGGGTGGG + Intergenic
956717003 3:72087777-72087799 AGGAGCTGCCACACCTGGGTGGG + Intergenic
962224674 3:133596069-133596091 TGGAGCCAAAACACCTGGGTTGG - Intergenic
964539122 3:157759331-157759353 TGGAAGTTCAAGACCAGCGTGGG - Intergenic
966902873 3:184499787-184499809 TGGGTGCTCAAGACCTGGGTGGG - Intronic
967840889 3:194003701-194003723 TGGAGCTCCTGGGCCTGGGTTGG + Intergenic
968129618 3:196185160-196185182 TGCAGCCTCTAGAGCTGGGTGGG + Intergenic
968552865 4:1232984-1233006 TGGATCTTCTAGACCTGAGAGGG + Intronic
968755272 4:2412510-2412532 TGGAGCTCCAGGGCCTGGCTGGG - Intronic
970377208 4:15471184-15471206 TGGAGCTTGGACACCTGGGGAGG - Intronic
970684805 4:18554603-18554625 TGGAGCTTCAAGATCCTGATGGG + Intergenic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
973945828 4:55954871-55954893 GGCCGCTTCAAGACCTGTGTGGG + Intronic
976379829 4:84386745-84386767 TGCAGCATGAAGAGCTGGGTAGG - Intergenic
977027552 4:91838691-91838713 TAGAGATTTCAGACCTGGGTTGG - Intergenic
979105711 4:116684379-116684401 TGGGGCTTCAGCACCTGTGTGGG + Intergenic
984983226 4:185302824-185302846 TGGAGGTTCAAGGACTGGGCAGG - Intronic
986130246 5:4923452-4923474 TGGAGGTTGAAGACATGCGTAGG - Intergenic
987989235 5:25189984-25190006 TGGAGCTGGAAGACCTGAGAAGG - Intergenic
990176203 5:53110773-53110795 TGGAGCTCACAGTCCTGGGTAGG + Intergenic
990950191 5:61291107-61291129 TGGAGCTACAGGAAGTGGGTGGG - Intergenic
993497724 5:88626748-88626770 TGGAAGTTCAAGACCAGCGTTGG - Intergenic
993733548 5:91449550-91449572 TGGAGCTTCTGGACCAGGGAGGG + Intergenic
996122075 5:119683926-119683948 TAGAGCTTGAATATCTGGGTTGG + Intergenic
996698468 5:126424119-126424141 TGGAACTTCAAGAGCAGAGTGGG + Intronic
997875630 5:137544366-137544388 TGGAGGTTCCTGACCTGAGTAGG + Intronic
997897784 5:137735438-137735460 TGGAGATTCAAGCCCTGGAACGG + Intronic
1000242593 5:159422526-159422548 TGGAGCTTGAACAACTAGGTCGG + Intergenic
1001062755 5:168507666-168507688 TGGAGCTCAAAGACCTTGTTGGG + Intronic
1001748263 5:174108630-174108652 AGGAGCTTCTAGAACTCGGTTGG - Exonic
1005512482 6:26522725-26522747 TGGAGCTCGAAGACCTGAGAAGG + Intergenic
1007671947 6:43562713-43562735 TGGAGTTTGACTACCTGGGTTGG + Intronic
1009842670 6:69096277-69096299 CGTAGCTTTGAGACCTGGGTTGG - Intronic
1015939018 6:138430831-138430853 TGGAGCTCCAAGCGCTGGGGAGG - Exonic
1017064779 6:150518725-150518747 TGGAGATCCTAGCCCTGGGTGGG + Intergenic
1018325838 6:162667722-162667744 TGGAGCTTGAATATCTGGATTGG + Intronic
1019980084 7:4615007-4615029 GGGAGCTCAAAGACCTGGGAAGG + Intergenic
1020430775 7:8114229-8114251 CGGAGCTTCAGGCCCTGGTTTGG - Intronic
1020938116 7:14493642-14493664 GGATGATTCAAGACCTGGGTGGG + Intronic
1021184833 7:17552431-17552453 AGGAGCTTCAGGATCTAGGTGGG + Intergenic
1021688139 7:23206924-23206946 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1021885263 7:25131481-25131503 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1022465370 7:30649773-30649795 TGAAGCCTCAAGACCTGTGAGGG - Intergenic
1022652945 7:32293832-32293854 TGGAGCTTTTACACCTGGTTGGG - Intronic
1023860446 7:44215033-44215055 AGGACCTGCCAGACCTGGGTTGG + Intergenic
1026574798 7:71563299-71563321 TGCAGCTTCCACAGCTGGGTAGG + Intronic
1031406364 7:121392109-121392131 TGGAGCTCCCAGATCTGGTTTGG + Intronic
1034458583 7:151185887-151185909 TGGAGATTCTAGACCTGTCTTGG + Intronic
1035088026 7:156278015-156278037 TGAGGCTTCAAGACCTGGATTGG + Intergenic
1035972718 8:4269263-4269285 TGGAGGTTCAAGACCAGCCTGGG - Intronic
1038422138 8:27440203-27440225 GGGAGCGTCAGGCCCTGGGTGGG - Intronic
1039581019 8:38666927-38666949 TGGAGCTCCTGGGCCTGGGTGGG - Intergenic
1040385523 8:46912685-46912707 TGGAGCTCCGAGGCCTGGGGTGG - Intergenic
1047836861 8:128703349-128703371 TGGACCTTTAAGAGGTGGGTAGG - Intergenic
1048507501 8:135034349-135034371 TGGATCCTCCAGACCTGGATGGG - Intergenic
1050169964 9:2805005-2805027 TGGAGCTTCACTGCTTGGGTGGG + Intronic
1051161050 9:14207645-14207667 TGAAGCTTCAGGACTTTGGTGGG - Intronic
1052348910 9:27438296-27438318 AAGAGCTCCCAGACCTGGGTAGG - Intronic
1055425665 9:76193678-76193700 TGGACCTTCAAAACCAGGGCAGG - Intronic
1056627095 9:88262893-88262915 TCAAGCTTTAAGACCAGGGTCGG + Intergenic
1057820113 9:98323652-98323674 GGGAGGTCCAAGGCCTGGGTGGG - Intronic
1058349166 9:104000258-104000280 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1059215201 9:112555164-112555186 TGGAGCAGCAAGGCCTGGTTTGG + Intronic
1061352595 9:130077492-130077514 TGGAGATTCAAGACAAGGCTAGG + Intronic
1062308021 9:135920536-135920558 TGCAGCTCCTAGTCCTGGGTCGG - Intergenic
1062418610 9:136467161-136467183 TGGAGCATAAAGTCCTGGGGTGG - Intronic
1187289379 X:17938272-17938294 TGGAACCAGAAGACCTGGGTAGG + Intergenic
1187945611 X:24423773-24423795 TGTAGCTTCAATAGCTGAGTGGG + Intergenic
1190435764 X:50423231-50423253 TGGAGCAACAAGACATGGGGTGG - Intronic
1191183595 X:57587217-57587239 TGGAGCAGGAAGTCCTGGGTAGG + Intergenic
1196405141 X:115353389-115353411 TGCAGATTCAGGTCCTGGGTTGG + Intergenic
1197274133 X:124458330-124458352 TGGAGCTTCTAGAACTTGGAGGG + Intronic