ID: 1078085544

View in Genome Browser
Species Human (GRCh38)
Location 11:8231257-8231279
Sequence CTGTGTGTATGTTGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078085544_1078085548 -7 Left 1078085544 11:8231257-8231279 CCAGCTTCCCAACATACACACAG 0: 1
1: 0
2: 4
3: 63
4: 441
Right 1078085548 11:8231273-8231295 CACACAGGCACCAAGTACAAAGG 0: 1
1: 0
2: 0
3: 20
4: 264
1078085544_1078085554 18 Left 1078085544 11:8231257-8231279 CCAGCTTCCCAACATACACACAG 0: 1
1: 0
2: 4
3: 63
4: 441
Right 1078085554 11:8231298-8231320 CCAATGTGATGTTCACCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 129
1078085544_1078085552 17 Left 1078085544 11:8231257-8231279 CCAGCTTCCCAACATACACACAG 0: 1
1: 0
2: 4
3: 63
4: 441
Right 1078085552 11:8231297-8231319 CCCAATGTGATGTTCACCACAGG 0: 1
1: 0
2: 1
3: 9
4: 109
1078085544_1078085549 -6 Left 1078085544 11:8231257-8231279 CCAGCTTCCCAACATACACACAG 0: 1
1: 0
2: 4
3: 63
4: 441
Right 1078085549 11:8231274-8231296 ACACAGGCACCAAGTACAAAGGG 0: 1
1: 0
2: 0
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078085544 Original CRISPR CTGTGTGTATGTTGGGAAGC TGG (reversed) Intronic
900194801 1:1370846-1370868 ATGTGTGTGTGTTGGGGGGCAGG - Intergenic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903343212 1:22667906-22667928 GTGTGTGTGTGTTGGGTAGGGGG - Intergenic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903452870 1:23466512-23466534 GTGTGTGTATGTTGGGATCAGGG - Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904613385 1:31737168-31737190 CTGGGTGTGTGTTGGGCAGGTGG - Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904887029 1:33746646-33746668 CTGTGTATGTGTTGGGGAGAGGG - Intronic
905286953 1:36887158-36887180 TTCTGTGTATGGTGGGAGGCAGG - Intronic
905446460 1:38031022-38031044 TTGTGTGCATCTTGGGAAGGAGG + Intergenic
906266265 1:44432569-44432591 CTGTTTGTCTGTTTAGAAGCAGG + Intronic
906474164 1:46156678-46156700 CTGTGTGCATGATGGTCAGCTGG - Intronic
908222757 1:62024647-62024669 GTGTGTGTGTGTTGGGAGGTGGG - Intronic
908682984 1:66682779-66682801 ATGTGTGTATGTAGGCAAGCAGG + Intronic
908688968 1:66755542-66755564 TTGAGTATATATTGGGAAGCAGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910566293 1:88646825-88646847 CTTTGTGTAGGTTGGGGAGCTGG - Intergenic
911672625 1:100623926-100623948 CTGTGTGTCTGTTTGTAGGCTGG - Intergenic
912552595 1:110493972-110493994 CTGAGTGTGTGCTGGGAAGGGGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
913533457 1:119749489-119749511 CTGTGTGCATGTTGGAAATACGG - Intronic
915141575 1:153771552-153771574 GCGTGTGTGTGTTGGGAAGGAGG - Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
918497581 1:185157235-185157257 GTGTGTGTGTGTTGGGAGGCGGG + Exonic
918534835 1:185562283-185562305 CTGTGCATATGTGGGGAAGGGGG + Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
920035010 1:203059995-203060017 ATGTGTGTGTGTTGGGGAGGGGG - Intronic
920757492 1:208748185-208748207 CTGTCTTTATGTTCTGAAGCAGG + Intergenic
921347805 1:214205020-214205042 CTGTGTGTTTGTTGTGATGGAGG + Intergenic
922702745 1:227771425-227771447 CTGTGTGCATGTTGGGCTGCAGG - Intronic
923221644 1:231899887-231899909 ATGTGTCTATTTTGGGAAGCAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924155260 1:241168748-241168770 ATGTGTGTGTGTTGGGGAGGTGG - Intronic
1063470686 10:6282409-6282431 CAGTGTGTCTGTTGGGAACATGG + Intergenic
1064098300 10:12440793-12440815 CTGTATATATGATGGGATGCAGG + Intronic
1064341036 10:14485512-14485534 CTGTGTATATGTGGGGATGGGGG - Intergenic
1064511636 10:16100388-16100410 CAGTGTGAATGTTGAGAAGTGGG + Intergenic
1064874608 10:19978995-19979017 AAGTGTGTATGTTGTGGAGCAGG + Intronic
1066046612 10:31600874-31600896 CTGTGTGTCTTCTGAGAAGCAGG - Intergenic
1067561601 10:47308508-47308530 CTTTGTTTCTGTTGGGAAGAAGG - Intronic
1069735420 10:70650785-70650807 CTGAGTGCATGTGGTGAAGCCGG + Intergenic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1072065419 10:91865040-91865062 CTTTTTGTTTGTTGGGAAGTTGG + Exonic
1073403779 10:103278859-103278881 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1073595976 10:104800564-104800586 GTGTGTGTGTGTTGGGGAGGCGG + Intronic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074211285 10:111337623-111337645 CTGTATGTATGTGGGGCAGTAGG + Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077083806 11:737489-737511 CTCTGTGTCTGTTGCAAAGCTGG - Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078804928 11:14689262-14689284 TTGTCTGTTTCTTGGGAAGCAGG + Intronic
1078845000 11:15112628-15112650 GTGTGTGTGTATTGGGAAGTGGG + Intronic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081766084 11:45610973-45610995 GTGTCTGTGAGTTGGGAAGCTGG - Intergenic
1081929979 11:46862669-46862691 CTGTGTGGATGTTCGGTAGGAGG + Exonic
1082700379 11:56422407-56422429 GTGTGTGTATGTTTGTAAGGAGG + Intergenic
1083268503 11:61558557-61558579 GTGTGTGTTTGTTGGGGAACAGG + Intronic
1083963984 11:66031501-66031523 CTGTGACTATTTTGAGAAGCTGG + Intergenic
1084042489 11:66550359-66550381 CTGTGTGTCTGTTGGGGATAGGG - Intronic
1084073421 11:66753205-66753227 GTGTGTGTATGCAGGCAAGCAGG + Intronic
1084609185 11:70191342-70191364 GTGTGTGTATGTTGGGATGGGGG + Intergenic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1085006770 11:73099207-73099229 GTGTGTTTATTTTTGGAAGCAGG - Intronic
1085196289 11:74673896-74673918 CTTTGTGTGTGTTGGGTAGGGGG - Intergenic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085662229 11:78378973-78378995 CTGTGTGATTCTGGGGAAGCTGG - Intronic
1086388992 11:86341178-86341200 GTATGTACATGTTGGGAAGCAGG - Intronic
1087242645 11:95797161-95797183 GTGTGTGTGTGTTGGGAGGGGGG - Intronic
1087617725 11:100507411-100507433 GTGTGTGTATGTGGAGAAGGGGG - Intergenic
1087709215 11:101530285-101530307 CTGTATGTACCCTGGGAAGCAGG + Intronic
1087843688 11:102946901-102946923 CTGTGTGTATGTAGAGATGGAGG + Intronic
1088059628 11:105631216-105631238 CTGTGATTATATTGGGAAGGAGG + Intronic
1088263273 11:107965300-107965322 GTGTGTGTATGTTGGGTGGAGGG + Intergenic
1088512559 11:110593391-110593413 GTGTGTATCTGTTGGGAAGAGGG - Intronic
1088736983 11:112735942-112735964 GTGTGTGTGTGTTGGGCTGCAGG + Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090568476 11:128021573-128021595 ATGTGTGTCTGCTGGGCAGCAGG + Intergenic
1090964846 11:131589703-131589725 ATGTGTGTATGTGTGGATGCAGG - Intronic
1091109283 11:132950660-132950682 CTGTGTGCATTTTTGGAAGGGGG + Intronic
1091395612 12:152692-152714 CTGTGTGTGTGTGGGGTGGCAGG - Intronic
1091848447 12:3676269-3676291 CTGTGTGTGTGTTGTGGGGCTGG - Intronic
1093863372 12:24195888-24195910 CTGTGTGTGTGTTTTGAAACAGG + Intergenic
1095207164 12:39451435-39451457 TGGTGTGTGTGTTGGGAAGTAGG - Intergenic
1095779488 12:46043770-46043792 CTGTGTGTGTGTTGCGAGGGTGG + Intergenic
1095866001 12:46972736-46972758 CTGTGTCTATGAGTGGAAGCAGG - Intergenic
1096255188 12:50058166-50058188 CTGTGTGTATGTTGGGAGTGGGG - Intronic
1096451593 12:51747121-51747143 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096912469 12:54998109-54998131 GTGTGTGTGTGTTGGGATGTTGG - Intergenic
1097201893 12:57286118-57286140 TTGTGTGTATGTTGGAGAGATGG + Intronic
1097661341 12:62434921-62434943 CTGTGTCTGAGTGGGGAAGCAGG + Intergenic
1098059905 12:66550685-66550707 TCGTGTGTATGTTGGGTAGGGGG + Intronic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1099430976 12:82585460-82585482 ATGTGTGTGTGTTGGGTAGAAGG - Intergenic
1100297987 12:93280427-93280449 CTGAGTGTTTTTTGGGAAGTAGG - Intergenic
1100364177 12:93904168-93904190 CAGTATGTATGTTGGGAAGTGGG - Intergenic
1100710586 12:97251983-97252005 GTGTGTGTTTGTTGGGAATGGGG + Intergenic
1101571722 12:105959650-105959672 ATGTGTGTGTGTTTGGGAGCTGG - Intergenic
1102677686 12:114669269-114669291 GTGTGTGTCTGTTGGGGGGCGGG - Intergenic
1104545993 12:129713460-129713482 CTTTGTGTGTTTTGGGAAGGAGG + Intronic
1104686031 12:130785017-130785039 CTGTGTGTATTCTGGGATGTTGG - Intergenic
1105213367 13:18270945-18270967 CTGTACGTATTCTGGGAAGCAGG - Intergenic
1105880109 13:24598031-24598053 CTGTGTGTGTGTTGGGAGTTGGG - Intergenic
1106476452 13:30102427-30102449 TTATGTGTATGTTGGCAGGCAGG - Intergenic
1107700408 13:43041542-43041564 CAATGTGTGTGTTGGGAGGCAGG - Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108436118 13:50403212-50403234 CTGTGCCTTTGCTGGGAAGCTGG + Intronic
1108603893 13:52017879-52017901 TGGTGTGTATGTTGGGATGGTGG - Intronic
1109075639 13:57831845-57831867 GTGTGTTGATGTTGGGAAGCGGG + Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1110744235 13:79034063-79034085 TCGTCTGTATGTTTGGAAGCAGG - Intergenic
1110828553 13:80002295-80002317 CTGTGTGTATGTTGAGGGGAGGG - Intergenic
1111577335 13:90172715-90172737 TTGTGTTTATGTTTTGAAGCAGG + Intergenic
1111735814 13:92138001-92138023 CTGTGTGTGTGTTGGGAGTAGGG + Intronic
1112452290 13:99523576-99523598 TTGTGTGTATTATGTGAAGCTGG + Intronic
1113874146 13:113584308-113584330 GTGTGTGCATGTGGGGGAGCGGG - Intergenic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115961832 14:38842718-38842740 GTGTGTATATATTGGGCAGCTGG - Intergenic
1117593728 14:57304829-57304851 CTGTGTGGATCTTGGGGAGTGGG - Intergenic
1117906160 14:60589705-60589727 CTCTATGTATGGTGTGAAGCAGG - Intergenic
1118331960 14:64822136-64822158 GTGTGTGTATGTGTGGAAGGTGG - Intronic
1119188786 14:72664325-72664347 GTGTGTGTGTGTTGGGAGGTCGG - Intronic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1119416905 14:74477029-74477051 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119416917 14:74477108-74477130 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119663573 14:76468019-76468041 CTTTGTGCTTGTTGGGAAGGTGG + Intronic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1121628877 14:95408304-95408326 GTGTGTGTGTGTTGGGAAAATGG - Intronic
1121958950 14:98240773-98240795 GTGTGTATATGTGGGGAAGGAGG + Intergenic
1122262508 14:100531360-100531382 CTGTCTGTGGGTGGGGAAGCTGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1124342991 15:28901934-28901956 GTGTGTGTATGTTGGGGGTCTGG + Intronic
1124485469 15:30111067-30111089 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124518107 15:30386200-30386222 ATGTGAGTATGTTGGGGAGCTGG + Intronic
1124540546 15:30580053-30580075 ATGTGAGTATGTTGGGGAGCTGG - Intergenic
1124758107 15:32427528-32427550 ATGTGAGTATGTTGGGGAGCTGG + Intergenic
1125440434 15:39696916-39696938 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1125922686 15:43534928-43534950 CTCTGTGGAGGTTGGCAAGCTGG - Exonic
1126798737 15:52281574-52281596 CTGTGTGCATGTTTGAAGGCAGG - Intronic
1127451776 15:59123677-59123699 TTGTGTGTATGTTGGGCGGGGGG + Intronic
1127577322 15:60304297-60304319 GTGTGTGTGTGTTGGGAAATAGG - Intergenic
1127998404 15:64169132-64169154 GTGTGTGTGTGTGTGGAAGCAGG + Exonic
1128650516 15:69409213-69409235 GTGTGTGTGTGTTGGGGAGTTGG - Intergenic
1129373164 15:75110451-75110473 CTCTGTGTCAGGTGGGAAGCCGG - Intronic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130292776 15:82618925-82618947 CTTTGTGTATGTGGGGCAGGGGG + Intronic
1130375358 15:83324155-83324177 CTGTGTGTTTGAGAGGAAGCAGG + Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131107780 15:89746496-89746518 CTGTGTGTGTGTGTGGAGGCGGG - Intergenic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1132138721 15:99370468-99370490 CTATGAGTATCTTGGGAAGGGGG + Intronic
1132860920 16:2071357-2071379 CTGTGTCTGTGTTGGGATGTGGG + Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1134217978 16:12331058-12331080 CTGTGTCTGTGTTTGGAAGGGGG + Intronic
1134412679 16:14016078-14016100 CTGTTTGTAAGCTGGGAGGCAGG + Intergenic
1134475731 16:14572034-14572056 TCATGTTTATGTTGGGAAGCTGG + Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134562582 16:15223413-15223435 CTGAGTGAAGGTTGGGAGGCTGG - Intergenic
1134923122 16:18135040-18135062 CTGAGTGAAGGTTGGGAGGCTGG - Intergenic
1135662780 16:24311008-24311030 CCGTTTCCATGTTGGGAAGCAGG + Intronic
1135919391 16:26634858-26634880 CTGAGTGGAGTTTGGGAAGCTGG + Intergenic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137267745 16:46883210-46883232 GTGTGTGTGTGTTGGGATGTGGG + Intergenic
1137568813 16:49551378-49551400 GTGTGTGTATTTTGGGAGGGGGG - Intronic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1137731328 16:50692946-50692968 GTGTGTGAGTGTTGGGAAGCAGG + Intergenic
1137731383 16:50693291-50693313 ATGTGTATGTGTTGGGAAGCGGG + Intergenic
1138515583 16:57534013-57534035 CTGTCTGGCTGTTGGGAGGCAGG - Intronic
1139527300 16:67524863-67524885 GTGTGTGTATGAGGGGAGGCAGG - Intronic
1139628300 16:68209828-68209850 CTGTGTGTGTGTTGGGGGGCAGG - Intronic
1140255889 16:73336101-73336123 CTGTGTGTATCTGGGGCGGCAGG + Intergenic
1140259563 16:73365720-73365742 CTGTGTTTATTTTGGTGAGCTGG - Intergenic
1141133926 16:81453577-81453599 CGGTGTGTGTGTTGGTAAACAGG - Intronic
1141244368 16:82292515-82292537 CTGTATGCATGTTGCCAAGCAGG + Intergenic
1144139877 17:12337833-12337855 GTGTATATATGTTGGGAGGCTGG + Intergenic
1144382936 17:14720696-14720718 ATGTGTATAGGTTTGGAAGCTGG - Intergenic
1145407181 17:22612109-22612131 TTTTGTGTATGTTGTGAAGTTGG + Intergenic
1145769733 17:27484609-27484631 TTGTGTGTATGCTGGGGATCAGG - Intronic
1146063686 17:29619810-29619832 CTGTGTGTTTTTTGGGGAGTGGG + Intronic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1147165120 17:38588988-38589010 CTGAGTGTGTGCTGGGAACCCGG - Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147570720 17:41568897-41568919 GTGTGTGTATGTTTGAAAGGTGG - Intronic
1148788018 17:50155234-50155256 GTGTGTGTGTGTTGGGGGGCGGG + Intergenic
1149539099 17:57455286-57455308 CTGTGTGTGAGTTGGGGGGCAGG - Intronic
1150225728 17:63523494-63523516 GTGTGTGTATGTTGGGGCGGGGG + Intronic
1150672756 17:67216270-67216292 CAGAGTGTATGCTGGGAAGTGGG - Intronic
1151015761 17:70551006-70551028 GTGTGTGTGTGTATGGAAGCTGG + Intergenic
1151094309 17:71478581-71478603 ATGTGTGTGTGTTGGGGGGCGGG - Intergenic
1151342100 17:73478081-73478103 CCCTGTGTATGTTGGGGATCAGG - Intronic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1151564389 17:74889485-74889507 CTGTGTATATGTTGGGGCGTTGG - Intronic
1151803647 17:76392020-76392042 CTGGGTAGATGTTGGGGAGCTGG + Exonic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152616066 17:81338450-81338472 CTGTGTGTGGGTTGGGGAGGGGG + Intergenic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1155052170 18:22158045-22158067 CTGTAGGTCTCTTGGGAAGCAGG - Intergenic
1155057126 18:22194712-22194734 ATGTGTGTGTGTTGGGAGGGGGG - Intronic
1155147529 18:23096625-23096647 GTGTGTGTATTTTGGGGAGCAGG + Intergenic
1156107333 18:33679650-33679672 TTGTGTGTATGTGGGAAAGAGGG + Intronic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156278336 18:35606861-35606883 GTGTGTGTGTGTTTGGAGGCTGG + Intronic
1156801032 18:41114206-41114228 GTGTGTGTGTGTTGGGGTGCAGG + Intergenic
1157987147 18:52451082-52451104 CTGTGGGCATGTTGTGAGGCAGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158189309 18:54807967-54807989 CTGTTTGTATCTTTTGAAGCAGG + Intronic
1158447049 18:57530774-57530796 TTGTGTGTATGTGGGGGAGGAGG - Intergenic
1160277099 18:77447114-77447136 CTGTGAATGTGTTGGGAATCAGG + Intergenic
1161393967 19:4035001-4035023 CTGTGTGTGTCTTGGGGAGGAGG + Intronic
1162042709 19:7980179-7980201 CTGTGGGTATCTTGTGAAGGCGG + Intronic
1162203785 19:9040475-9040497 CTGGTTGTATGTTTGTAAGCAGG - Intergenic
1162497434 19:11031072-11031094 CTGTTTGTATTTTGGGAAACAGG - Intronic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165409583 19:35651094-35651116 CTCTGTGTATGTTGAGAGGCAGG + Intronic
1166424794 19:42668098-42668120 GTGTGTGTGTGTTGGGAAAAGGG - Intronic
1166846900 19:45733873-45733895 CTCTGTTTGTGTTGGGAATCCGG + Intronic
1167112898 19:47472184-47472206 GTGTGTGTGTGTTGGGGGGCGGG - Intergenic
1168333202 19:55581134-55581156 GTGTGTGCATGTTGGGGAGCCGG - Intergenic
925747137 2:7052828-7052850 GTGTGTGTGTGTTGGAAAGGGGG - Intronic
926349202 2:11980276-11980298 CTGTGTGAATGTGTGCAAGCTGG - Intergenic
927242789 2:20933139-20933161 CTGTATGTATGTTGGGGAGAGGG + Intergenic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927463543 2:23320445-23320467 CTGTGTGTGTGTGGGGGGGCGGG - Intergenic
927888766 2:26735198-26735220 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929667992 2:43848668-43848690 TTGTGTGTATGTTGGGCAGGGGG - Intronic
930370513 2:50495409-50495431 GTGTGTGTGTGTTGGGATGGGGG + Intronic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
932414598 2:71566001-71566023 GTGTGTGTGTGTTGGGCAGCAGG + Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
935035674 2:99370221-99370243 CTGTGTATATGTTGAGGAGTTGG + Intronic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
937212317 2:120282547-120282569 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
937245259 2:120488363-120488385 GTGTGTGTATGTGGGGATGGGGG + Intergenic
938120153 2:128627325-128627347 ATCTGTGTGTGTTGGGAAGCGGG + Intergenic
938549535 2:132367574-132367596 TTGTTTGTTTGTTTGGAAGCGGG + Intergenic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
940663977 2:156584110-156584132 CTGTGTGTGTGTCGGGATGGGGG - Exonic
940823195 2:158380939-158380961 CTATGTGACTGTTGGGAAGTAGG - Intronic
941112730 2:161434211-161434233 GTGTGTGCATGGTGGGAGGCAGG - Intronic
941208733 2:162609048-162609070 GTGTGTGTGTGTTGGGGGGCTGG - Intronic
941883274 2:170503074-170503096 TTGTGTGCGTGTTGGGAGGCAGG - Intronic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
943365980 2:186967872-186967894 TTGTGTGGATGGTGGGCAGCAGG + Intergenic
943648620 2:190432819-190432841 GTGTGTGTGTGTTGGGGGGCGGG - Intronic
944193079 2:197024021-197024043 CTGTGAGTATGTGGGGAGACAGG + Intronic
944658381 2:201899484-201899506 CTGTGTGGATATTTGGAAGAGGG - Intergenic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946075099 2:217067204-217067226 CTGTGTGTTTCTTGGGAGGCAGG - Intergenic
946594214 2:221288351-221288373 CTGTGAGTAAGCTTGGAAGCTGG - Intergenic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
947020284 2:225666854-225666876 CTGTGTGTGTGTTGGGGGGGTGG - Intergenic
947360405 2:229340272-229340294 GTGTGTGTCTGGTGGGAGGCTGG - Intergenic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
948264042 2:236624714-236624736 CTTGGTGTAGGTTGGGTAGCAGG + Intergenic
948360788 2:237418722-237418744 CTGTCTGGATGCTGGGATGCGGG - Intergenic
948964603 2:241367962-241367984 CTGTGTGTATGTGGGGGTGGAGG - Intronic
1168806186 20:673642-673664 CTGAGTGAATAGTGGGAAGCAGG - Intronic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1168892947 20:1306386-1306408 CTGTCTTCATGTGGGGAAGCCGG + Exonic
1169529315 20:6467127-6467149 CTTTGTGTCTTGTGGGAAGCAGG + Intergenic
1169947539 20:11005392-11005414 GTCTGTGTGTGTTGGCAAGCAGG - Intergenic
1170476974 20:16725114-16725136 GTGTGTGTGTGTTGGGCAGGAGG + Intergenic
1170599798 20:17832464-17832486 TTGTGTGTTTGTGGGGATGCTGG + Intergenic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1173290801 20:41713315-41713337 GTGTGTGTGTCTTGGGAAGAAGG - Intergenic
1173667040 20:44770462-44770484 CTGTGTGTATTGGGGGAAACTGG + Intronic
1173964829 20:47104601-47104623 TTGTGTGTATGATGTGAGGCAGG + Intronic
1174597129 20:51693115-51693137 CAGTGTGTATGATGGGGCGCAGG - Intronic
1175952595 20:62591325-62591347 CCCTGCGGATGTTGGGAAGCTGG + Intergenic
1176334128 21:5579890-5579912 CAGTGTGCATGTTAGGAGGCTGG + Intergenic
1176393629 21:6241062-6241084 CAGTGTGCATGTTAGGAGGCTGG - Intergenic
1176467790 21:7075112-7075134 CAGTGTGCATGTTAGGAGGCTGG + Intronic
1176491351 21:7456890-7456912 CAGTGTGCATGTTAGGAGGCTGG + Intergenic
1176509291 21:7681493-7681515 CAGTGTGCATGTTAGGAGGCTGG - Intergenic
1176936317 21:14871768-14871790 GTGTGTGTGTTTTGGGATGCTGG + Intergenic
1178533272 21:33392672-33392694 CTGGGTGTGTGTTGGGAGGGGGG + Intergenic
1179151078 21:38808617-38808639 TTGGGTGTGTGTTGGGTAGCAGG + Intronic
1180900040 22:19364065-19364087 CTATGGGTATGTTGGGGAGGCGG + Intronic
1182234213 22:28862897-28862919 TTTTGTGTATGTTGTGATGCAGG + Intergenic
1183519009 22:38285495-38285517 CTGTGTGTGTATGGGGGAGCGGG + Intergenic
1183727582 22:39598054-39598076 CTGTGTGTGTGGTGGGTTGCGGG + Intronic
1184818811 22:46893326-46893348 TTCTGTGTATGATGGGAGGCAGG + Intronic
1184988876 22:48154287-48154309 GGGTGTGTATTTTGGGGAGCGGG - Intergenic
949661964 3:6290143-6290165 CTATGTCTATTTTGGGAGGCTGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949817820 3:8078867-8078889 CTGTGTTTAAGTTAGGAAACAGG + Intergenic
950450361 3:13061794-13061816 GTGTGTGTTTGTTGGGACGGGGG - Intronic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950656410 3:14439753-14439775 TTGTGTGTGTGTGAGGAAGCTGG + Intronic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
951129212 3:19022015-19022037 GTGTGTGTATTTGGAGAAGCAGG - Intergenic
951880389 3:27475657-27475679 CTGTTTGTATCTGGGGAAGTTGG - Intronic
952007371 3:28857517-28857539 CTGAGTGTAGATTGGGTAGCTGG + Intergenic
952270803 3:31829599-31829621 GTGTGTCTATGAGGGGAAGCAGG + Intronic
952529328 3:34247302-34247324 CTTTATATATGTTGAGAAGCAGG - Intergenic
953299061 3:41753211-41753233 CTGTGTGTATTTTTGGAGACAGG - Intronic
953313134 3:41900038-41900060 ATGTGAGTATGTTGGGGAGCTGG + Intronic
954553746 3:51502775-51502797 CTATGTGCATGTTGGGGAGGGGG - Intergenic
954662921 3:52235719-52235741 CTGTGTGCGTGTTAGCAAGCCGG - Intronic
955429438 3:58827408-58827430 TTGTGTGTATGTTGGGTGGGGGG + Intronic
956298176 3:67737575-67737597 ATGTGTGTATGTTTGGAGGAGGG - Intergenic
956909005 3:73797439-73797461 ATGTGTGGATGGTGGGAAACAGG - Intergenic
957454713 3:80426662-80426684 TTTTGTGTATGTTGGGAAAGAGG + Intergenic
957590029 3:82184859-82184881 GTGTGTGTATGTTGGGATGGGGG + Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
958065674 3:88542471-88542493 GTGTGTGTGTGTTGGGATGATGG + Intergenic
959192886 3:103138153-103138175 CTGGCTCTATTTTGGGAAGCTGG - Intergenic
959274378 3:104259202-104259224 CTGTGTGTATCCTGGGAATTGGG + Intergenic
959397167 3:105854992-105855014 CTGTGGGTATTTTTGGAATCTGG + Intronic
959948831 3:112155473-112155495 CTGTGTGTATGTTGGGCTATTGG + Intronic
960049865 3:113229032-113229054 CTGGGTATATGTTGGGCAGCAGG + Intronic
960187767 3:114664594-114664616 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
960959432 3:123059078-123059100 GTGTGTGTATGTTGGGATATGGG + Intergenic
961029230 3:123587501-123587523 CTGTGTGTGTGTTGGGGGGGGGG - Intergenic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
961616160 3:128182853-128182875 CTCTGTGGCTGGTGGGAAGCAGG - Intronic
961869932 3:129979993-129980015 CCGTGTGTGTGTTGGGGAGAAGG - Intergenic
962492997 3:135911616-135911638 AAGTGGGTCTGTTGGGAAGCAGG + Intergenic
963215021 3:142735782-142735804 GTGTGTGTGTGTTGGGAGGGTGG + Intronic
964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG + Intergenic
965074354 3:163957562-163957584 TTGTGAGTAAGTGGGGAAGCAGG - Intergenic
966148883 3:176844225-176844247 TTTTGTGTGTGTTGGGAAGTTGG + Intergenic
966717771 3:183030696-183030718 AAGTGTGTATGTTGAGAAGCTGG - Intronic
967389959 3:188946163-188946185 CCTTGTATATGTTGGGAAGAAGG + Intergenic
968085968 3:195874031-195874053 CTGTGTGCGTGCTGGGGAGCCGG - Intronic
969075495 4:4574862-4574884 GTGTGTGTGTGTTGGGAGGAAGG - Intergenic
970454317 4:16207076-16207098 CTGTGTGGCTGCTGAGAAGCAGG - Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
974921038 4:68239333-68239355 CTGTGTGTATTTTGGGAGATGGG - Intronic
975172950 4:71253807-71253829 CTGCGTGTGTGTTGGGAAGGAGG + Intronic
975337684 4:73199247-73199269 GTGTGTGTGTGTTGGGAGGAGGG + Intronic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
978103236 4:104869273-104869295 CTGTGTGTGTGCTGGGAACTGGG + Intergenic
978340514 4:107717742-107717764 CTGTGTGGAAATTGGGAAGTAGG - Intronic
978827601 4:113043587-113043609 CATTGTGAATTTTGGGAAGCTGG + Intronic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
980538947 4:134167291-134167313 CTGTGTGCATGTGTGGTAGCAGG + Intergenic
981222209 4:142250199-142250221 GAATGTGTATGTTGGGAATCTGG - Intronic
981652882 4:147079062-147079084 CTGAGTGTATGTTATGAGGCAGG - Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
983794183 4:171839539-171839561 ATGTGTGTGTGTTGGGAATGGGG - Intronic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
983959725 4:173737944-173737966 CAGTGTGTATATTGGGATGATGG - Intergenic
984405865 4:179328984-179329006 GTGTGTGTGTGTTGGGATGTGGG - Intergenic
984877981 4:184386323-184386345 CTGAGTCTGTGTTGGGAAGAAGG + Intergenic
984915004 4:184715133-184715155 CTGTGTGTATGTTTAGCAGGTGG + Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986374417 5:7115572-7115594 TTTTGTGTCTGTTGGGAAGCTGG + Intergenic
987761285 5:22165465-22165487 GTGTATGTGTGTTGGGAGGCTGG - Intronic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
989439339 5:41451950-41451972 TTGTGTGCATGTTGAGAAACAGG + Intronic
990271480 5:54146149-54146171 TTGTGTGTATGGTGTGAGGCAGG - Intronic
991365827 5:65867011-65867033 CTGTTTGTATGTTAGGTACCTGG - Intronic
991896076 5:71398919-71398941 GTGTATGTGTGTTGGGAGGCTGG - Intergenic
992374632 5:76176114-76176136 CTGTGTGTGTGTTGGGGTGGGGG - Intronic
993045277 5:82859323-82859345 GTGTGTGTATGTTGGGAGGGAGG - Intergenic
993861868 5:93145987-93146009 CTGAGTGTATGCAGGGGAGCTGG - Intergenic
993878023 5:93330772-93330794 CTGTGTCTATGTTGGTAAACTGG - Intergenic
994750052 5:103726463-103726485 CTGTGGATTTGTTAGGAAGCAGG - Intergenic
994790543 5:104221150-104221172 ATGTGTGTATGTAGGGAATGGGG + Intergenic
995245718 5:109933001-109933023 GTGTGTGTATGATGGGAATGGGG + Intergenic
995261326 5:110107556-110107578 CTGTGTGTCTTTTGGGAATGAGG + Intergenic
995467945 5:112470101-112470123 CTGTGTGTATGTTGGTTATGAGG - Intergenic
995576967 5:113547171-113547193 CTGTGTGTATTTTGAGCAGAAGG - Intronic
995754822 5:115491620-115491642 GTGTGTGTGTGTTGGGTGGCGGG + Intergenic
996994838 5:129683226-129683248 ATGTGTGTATGTGGGGGAGGGGG + Intronic
997130044 5:131267515-131267537 ATGTGTGTCTGTTGGGGAGAGGG + Intronic
997144313 5:131415861-131415883 TTGTGTGTAAGTTGGTAAGCTGG + Intergenic
998403008 5:141857805-141857827 CTGTGCCAATATTGGGAAGCTGG - Intronic
998869745 5:146540473-146540495 CTGTGTGTATGCTGAGAATAGGG + Intergenic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999617739 5:153442931-153442953 TTGTGTGTATGTTTGGGAACTGG - Intergenic
1000346140 5:160315308-160315330 GTGTGTGTGTGTTGGGGGGCGGG - Intronic
1000578165 5:163002028-163002050 CTGTTTGTGTGTTTGGGAGCAGG - Intergenic
1001450592 5:171821431-171821453 CTGTGGCTATGTTTGGAAGCTGG + Intergenic
1003038311 6:2664282-2664304 CTTTGTGGATATTGGGAAGTAGG + Exonic
1004244218 6:13956911-13956933 GTGTGTGTATGGTGGGGGGCGGG - Intronic
1004771292 6:18785553-18785575 CTGTGTGTATGTAGGTATGGGGG - Intergenic
1004819786 6:19354927-19354949 CTGTGTGTATGTTGGTGTGCTGG - Intergenic
1005252477 6:23963287-23963309 CTGTGTCTTTGTTGGGAAAGAGG - Intergenic
1005389939 6:25322798-25322820 CTGTGTGAATATTGAGAAGGAGG - Intronic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006845449 6:37058217-37058239 CAGTGTCTATGTTGGGGAGTGGG + Intergenic
1006865220 6:37204322-37204344 CTGTGTGTATGTTTGTAATCTGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007592039 6:43027715-43027737 CTGTGTGTGTGTTGGGGGGGGGG - Intronic
1007801852 6:44401246-44401268 CTGAGTGTTTGGTGGGAAGTAGG + Intronic
1007994059 6:46287466-46287488 GTGTGTGTATTTTGGGAAGTGGG - Intronic
1008322143 6:50129125-50129147 TTGTGTGTTTGTGTGGAAGCAGG + Intergenic
1011557848 6:88588141-88588163 CAGTGGGTGGGTTGGGAAGCGGG - Intergenic
1011726314 6:90213750-90213772 CTGTATGTATGTAAGGCAGCGGG - Intronic
1011798181 6:90980618-90980640 CTGAGTTTATGTTTGGTAGCAGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013609690 6:111782844-111782866 CTGTGAGACTGATGGGAAGCTGG - Intronic
1013609969 6:111785481-111785503 GTTTGTGTGTGTTGGGAAGCGGG - Intronic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1014461385 6:121699837-121699859 GTGTGTGTGTGGTGGGAATCAGG + Intergenic
1014561479 6:122896224-122896246 CTGTGTGTATGTTGGGTTGTGGG + Intergenic
1015752942 6:136579235-136579257 CTGTGTGTGTGTTGGGGTGGTGG - Intronic
1016782995 6:147980513-147980535 TTGTGTGTGTGTTGGGTAGGAGG - Intergenic
1017590835 6:155976498-155976520 CAGTGTGTATTCTGGGAAGAGGG - Intergenic
1019262646 7:90229-90251 CTTTGTGTATGTTGGGAAACAGG + Intergenic
1021406880 7:20280427-20280449 TTGTGTGTGTGTTGGGGAGGTGG + Intergenic
1021487840 7:21186847-21186869 GTGTGTGTGTGTTGGGAGACTGG - Intergenic
1021691766 7:23237100-23237122 GTGTGTGTGTGTTGGGCAGCAGG - Intronic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022518717 7:30992134-30992156 GTGTGTGTGTGTTGGGGGGCGGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024207292 7:47174721-47174743 CTCTGTGTAGAATGGGAAGCTGG - Intergenic
1024392756 7:48834250-48834272 CTGTGTATGTGTTGGGGAGTAGG + Intergenic
1024556516 7:50607824-50607846 GGGTGTGTAGGTTGGGATGCTGG - Intronic
1026879064 7:73897092-73897114 CTGTGTTCCTGTGGGGAAGCAGG - Intergenic
1027861799 7:83593324-83593346 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028233625 7:88333975-88333997 GTGTGTGTGTATTGGGGAGCAGG + Intergenic
1028495944 7:91461272-91461294 GTGTGTGTATGTTGGGGTGGGGG + Intergenic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1029221752 7:98995688-98995710 GTGTGTGTATGATGGGATGGGGG - Intronic
1029513120 7:101009158-101009180 CTGTGAGTATATTGGGGGGCAGG + Exonic
1030678331 7:112408085-112408107 CAGTGTGAATTTTGGCAAGCAGG - Intergenic
1031035997 7:116788471-116788493 GTGTGTGTTTGTTGGGGAGGTGG - Intronic
1031326695 7:120408670-120408692 GTGTGTGTCTGTTGGGGGGCAGG - Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032792747 7:135254382-135254404 CTGTGTGTCTGTAGGACAGCTGG - Intronic
1033571199 7:142630443-142630465 GTGTGTGTGTGTTGGGGAGGAGG - Intergenic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1034387366 7:150751618-150751640 CTGTGTCTCTGTTGGGGGGCAGG - Intergenic
1034725336 7:153330598-153330620 TTGTGTGTGTGTTGGGGAGCTGG + Intergenic
1035436516 7:158863811-158863833 CTGGGTGTTTGGTGGGGAGCCGG + Intronic
1040534809 8:48299537-48299559 GTGTGTGTGTGTTGGGGAGGCGG - Intergenic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042860558 8:73309064-73309086 GTGTGTGTATGTGGGTAAGGGGG - Intronic
1043184963 8:77137044-77137066 GTGTGTGTATGTTGGGATGTGGG + Intergenic
1043668615 8:82851229-82851251 TTGTGTGTATGTGGGGGAGGGGG + Intergenic
1044757485 8:95480117-95480139 GTGTGTGTGTGTTGGGGGGCAGG + Intergenic
1046144288 8:110137355-110137377 GTGTGTATATGTTGGGATGAGGG + Intergenic
1046838865 8:118835169-118835191 GTGTGTGTGTGTTGGGAGGGAGG + Intergenic
1047087871 8:121539340-121539362 TTGTGTGTATGTTCTGAGGCAGG + Intergenic
1047243017 8:123110646-123110668 GTGTGTGTATGTTGGGATGTGGG - Intronic
1048255047 8:132899271-132899293 CTCTGTGTGTGTTGAGAACCTGG - Intronic
1048463539 8:134642720-134642742 CTGTGCGAGTGCTGGGAAGCTGG - Intronic
1048577769 8:135706444-135706466 CTGTGTGTAGTTTGGGAGGTAGG - Intergenic
1048933117 8:139332297-139332319 GTGTGTGTGTGTTGGGCAGGGGG - Intergenic
1049570390 8:143367653-143367675 CTGTGTGCTTGTTGCGGAGCCGG + Intergenic
1050233559 9:3554816-3554838 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
1050615959 9:7402054-7402076 GTGTGTGTGTGTTGGGAAAGGGG - Intergenic
1052364254 9:27594214-27594236 TTTTGTATATGTTGAGAAGCAGG - Intergenic
1054923219 9:70562602-70562624 TTGTGTGTGTGTTGGGCAGGGGG + Intronic
1058617815 9:106852534-106852556 CTGTGTTTGTGTTTGGAGGCTGG - Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1059065105 9:111075484-111075506 GTGTGTGTATGGTGGGAATTAGG - Intergenic
1059529901 9:115026316-115026338 CATTGAGTATGTTGGGAATCAGG - Intronic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1060820962 9:126661490-126661512 CTGTCTGTTTGTGGGGCAGCAGG + Intronic
1061382160 9:130265331-130265353 TTGTGTGTGTGTTGGGGGGCGGG + Intergenic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062118997 9:134824019-134824041 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1186310297 X:8310301-8310323 GTGTGTTTATGTGGGGAAGAAGG + Intergenic
1186356279 X:8794569-8794591 GTGGCTGTATGTTGGGAAGATGG - Intronic
1186378024 X:9028798-9028820 GTGGCTGTATGTTGGGAAGTTGG - Intronic
1186502190 X:10060412-10060434 TTGTGTGTGTGTTGGGGAGGGGG + Intronic
1186580394 X:10811468-10811490 CAGTGTGTAAGTGGAGAAGCTGG + Intronic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1186795066 X:13039298-13039320 GTGGCTGTATGTTGGGAAGATGG - Intronic
1187038478 X:15567280-15567302 GTGTGTGTGTGTTGGGCAGGGGG - Intronic
1187098734 X:16170907-16170929 CTATGTGCTTGTTGGCAAGCTGG + Exonic
1187281045 X:17859018-17859040 CTGTGTGTATGTGGGGGTGTGGG + Intronic
1188805481 X:34583384-34583406 GTGTGTGTATGATGGTAAGTGGG - Intergenic
1189132493 X:38514747-38514769 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1189992381 X:46607482-46607504 TTGTGTGTTGATTGGGAAGCTGG - Intronic
1190056828 X:47186026-47186048 GTATGTGAATGTTGGGGAGCTGG - Intronic
1190057449 X:47189928-47189950 GTGTGTGTATGTTGGGGCGTGGG + Intergenic
1190279151 X:48918232-48918254 CTGTGTATGTGTGGGAAAGCAGG - Intronic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1192617677 X:72645007-72645029 CTGTGTGTTTTTTAGGCAGCAGG + Intronic
1195272226 X:103243103-103243125 CTGTGTGTATGGTGGGAGTGTGG - Intergenic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195748086 X:108138365-108138387 CTGTGTGCCTGATGGAAAGCAGG + Intronic
1196298211 X:114023588-114023610 CTGTGTGTGTGTTGGTAGGGGGG + Intergenic
1196796022 X:119502587-119502609 GTGTGTGAATGCTGGGATGCAGG + Intergenic
1197163069 X:123345429-123345451 GTGTGTGTGTGTTGTGAAGGGGG - Intronic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1198435502 X:136613098-136613120 GTGTGTGTGTGTTGGGGGGCGGG + Intergenic
1200282284 X:154787091-154787113 GTGTGTGTGTGTTTGGGAGCAGG - Intronic
1200342588 X:155413829-155413851 TTTTGTGTATGTTGTGAAGTAGG - Intergenic
1200755682 Y:6987904-6987926 CTGTGTGTGTGTTGGGGTGGAGG + Intronic
1200831314 Y:7690460-7690482 CTGTGGGTCTTTTGGGGAGCGGG + Intergenic