ID: 1078086754

View in Genome Browser
Species Human (GRCh38)
Location 11:8238382-8238404
Sequence TGCTTGGAGGATGGGCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1027
Summary {0: 1, 1: 0, 2: 5, 3: 103, 4: 918}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078086745_1078086754 16 Left 1078086745 11:8238343-8238365 CCCAAACAGGCAAAACCGATCTG 0: 1
1: 0
2: 3
3: 14
4: 122
Right 1078086754 11:8238382-8238404 TGCTTGGAGGATGGGCGCGGTGG 0: 1
1: 0
2: 5
3: 103
4: 918
1078086747_1078086754 1 Left 1078086747 11:8238358-8238380 CCGATCTGATGTCAGAATAATGG 0: 1
1: 0
2: 3
3: 11
4: 142
Right 1078086754 11:8238382-8238404 TGCTTGGAGGATGGGCGCGGTGG 0: 1
1: 0
2: 5
3: 103
4: 918
1078086746_1078086754 15 Left 1078086746 11:8238344-8238366 CCAAACAGGCAAAACCGATCTGA 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1078086754 11:8238382-8238404 TGCTTGGAGGATGGGCGCGGTGG 0: 1
1: 0
2: 5
3: 103
4: 918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078086754 Original CRISPR TGCTTGGAGGATGGGCGCGG TGG Intronic