ID: 1078087904

View in Genome Browser
Species Human (GRCh38)
Location 11:8245233-8245255
Sequence AGCAAGGCAGGGCCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 1, 2: 8, 3: 44, 4: 423}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078087904_1078087909 -1 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087909 11:8245255-8245277 TTAGAGACACATCTGAGGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 337
1078087904_1078087908 -6 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087908 11:8245250-8245272 CTTGCTTAGAGACACATCTGAGG 0: 1
1: 0
2: 0
3: 14
4: 141
1078087904_1078087910 0 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087910 11:8245256-8245278 TAGAGACACATCTGAGGCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 184
1078087904_1078087911 6 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087911 11:8245262-8245284 CACATCTGAGGCAAGGGTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 155
1078087904_1078087913 12 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087913 11:8245268-8245290 TGAGGCAAGGGTTCAGGCCAGGG 0: 1
1: 0
2: 2
3: 27
4: 260
1078087904_1078087915 25 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087915 11:8245281-8245303 CAGGCCAGGGACTTGGACTCTGG 0: 1
1: 0
2: 2
3: 31
4: 366
1078087904_1078087912 11 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087912 11:8245267-8245289 CTGAGGCAAGGGTTCAGGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 292
1078087904_1078087914 18 Left 1078087904 11:8245233-8245255 CCATGTCTGGGCCCTGCCTTGCT 0: 1
1: 1
2: 8
3: 44
4: 423
Right 1078087914 11:8245274-8245296 AAGGGTTCAGGCCAGGGACTTGG 0: 1
1: 0
2: 0
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078087904 Original CRISPR AGCAAGGCAGGGCCCAGACA TGG (reversed) Intronic
900504634 1:3023205-3023227 TGCTAGGTAGGGCCCACACAGGG - Intergenic
900763592 1:4488779-4488801 GTCAAGGAAGGGCCCAGCCATGG + Intergenic
900935100 1:5759914-5759936 AGCAGGGCAGGGCCCAGCCATGG - Intergenic
901769384 1:11522706-11522728 ACCCAGCCAGGGCCCAGCCAGGG + Intronic
901881628 1:12197481-12197503 AGCCTGGCAGGGCTCAGCCAGGG - Intronic
901916202 1:12502482-12502504 AGCGACACTGGGCCCAGACATGG + Intronic
902416781 1:16244413-16244435 AACAAGGCAGGGGCCAGGGACGG + Intergenic
904089576 1:27935344-27935366 AGCAAGGCAGGAGCTAGGCAGGG + Intronic
904187756 1:28719232-28719254 AACAAGGCAGGGACCAAACAGGG - Intronic
904874655 1:33644731-33644753 AGCAATGGAGGTCCCAGACTGGG + Intronic
905222450 1:36458021-36458043 AGGAAGGAAGGGCCCAGGCCTGG + Intronic
905514486 1:38552104-38552126 AGAAACCCAGGGCCCAGAGAGGG - Intergenic
906163812 1:43670849-43670871 AGCCAGGCATGGGCCAGGCATGG - Intronic
906538981 1:46570442-46570464 TGCAAGTCAGGGCCCCAACATGG + Intronic
907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG + Intronic
907358827 1:53898210-53898232 AGCAGGGCAGGGCACAGAGGAGG + Intronic
908215748 1:61949907-61949929 AGCAAAGAAGGGACCAGGCACGG + Intronic
908393523 1:63704582-63704604 AGGAAGGCAGGAACCAGGCATGG - Intergenic
910672264 1:89785106-89785128 AGCAAGGCAGTTCTCAGCCAAGG + Intronic
913045399 1:115069563-115069585 AGGAAAGCAGGGCCAAGAGATGG + Intronic
915934944 1:160084934-160084956 AGGAAGGCAGGGGCGAGACTAGG + Intronic
916188569 1:162157077-162157099 AGCAAGGGAAGGCCGAGGCATGG + Intronic
916248176 1:162709164-162709186 AGCAAGCCTGGTCTCAGACAAGG + Intronic
918043426 1:180926929-180926951 ACCCTGGCAGGGCCCAGGCATGG - Intronic
920033141 1:203049211-203049233 AGAGAGGCAGGGCCCAGTGAGGG + Intronic
920415991 1:205799734-205799756 AAGAAGGCAGGGACCAGAGAGGG - Intronic
920563936 1:206959026-206959048 AGGAGTGCAGGGCCCAGACCTGG - Intronic
920962472 1:210675795-210675817 AGCAAGACAGAGGCCAGAGAGGG + Exonic
921161443 1:212475084-212475106 AGCAAGGCAGGTTCCACCCAAGG - Intergenic
922103406 1:222492453-222492475 GGCAGGGCAGGGGCCAGACATGG + Intergenic
922749019 1:228062156-228062178 ATCCAGTCAGGGCCCAGAGATGG - Intergenic
923025375 1:230199737-230199759 GACAAGGCAGGGCCCACACCAGG + Intronic
1062885123 10:1010696-1010718 AGCATAGCAGAGCCCAGCCAGGG - Intronic
1064199848 10:13275057-13275079 AGCAAGGCAGGTCCCACAGGTGG - Intergenic
1064243909 10:13654531-13654553 AGAAAGGCAGAGAGCAGACAGGG + Intronic
1064323071 10:14323951-14323973 AGAAAAGCAGAGCCAAGACATGG + Intronic
1064886169 10:20114821-20114843 AGCCAGGCAGTGACCAGACCAGG + Intronic
1068630692 10:59294468-59294490 TCCAAGGCAGTTCCCAGACAAGG + Intronic
1069620830 10:69836329-69836351 ATCAAGGCGGGGCCAAGGCAGGG + Intronic
1070639627 10:78158380-78158402 AGCAAGGCAGAGTCCAGGCTTGG + Intergenic
1070648237 10:78216188-78216210 AGGAAAGCCAGGCCCAGACAAGG + Intergenic
1070795403 10:79213406-79213428 AGGAAGTCAAGGCCCAGAGAGGG - Intronic
1070991887 10:80740227-80740249 AGCAGGGCAGGGACCTGAAATGG - Intergenic
1071275768 10:84053590-84053612 AGCAAGCCAGCCCCCAGACTCGG - Intergenic
1071569950 10:86691327-86691349 AGCAAGGCACAGCCCTGGCATGG - Intronic
1073062700 10:100741965-100741987 AGGAAGGCAGGTCCCGGCCACGG + Intronic
1073083317 10:100873335-100873357 AGCCAGGCAGGGATCAGAGATGG + Intergenic
1073262461 10:102200994-102201016 CGCAAGGCAGGGCTCAGGAATGG - Intergenic
1074753951 10:116610801-116610823 AGCAAGGTAGGTCCCAGGCCAGG + Intergenic
1075046572 10:119151077-119151099 AGCAAGTCAGTGGCCAGGCATGG + Intronic
1075086443 10:119417277-119417299 AGGAAGGCAGGGGCCAGGCCTGG - Intronic
1076020541 10:127069144-127069166 ACCAAGGCAGGGCAGACACACGG - Intronic
1076798320 10:132809408-132809430 TGCAGAGCAGGGCACAGACACGG - Intronic
1077050565 11:564552-564574 ATCAGGGCAGGGGCCAGGCATGG + Intergenic
1077101431 11:824229-824251 GCCAAGTCAGGGCACAGACAGGG + Intronic
1077155546 11:1089358-1089380 AGCCAGCCAGGGCCCCGGCAGGG - Intergenic
1077193018 11:1263337-1263359 AGATAGGCAGGGGCCTGACAAGG + Intergenic
1077196297 11:1282200-1282222 AGCAGGGAGGGGCCCAGAGAAGG + Intronic
1077197655 11:1289287-1289309 GAAAAGGCAGGGCCCAGGCAGGG + Intronic
1077275770 11:1706922-1706944 AACATGGCAGTGCCCAGACAAGG - Intergenic
1077358950 11:2131259-2131281 TGAGAGGCAGGGCACAGACAGGG + Intronic
1078087904 11:8245233-8245255 AGCAAGGCAGGGCCCAGACATGG - Intronic
1078215624 11:9309585-9309607 AGCAAGGCAGGATCTAGACCAGG + Intronic
1078291618 11:10016065-10016087 AGCAAGGTGGGGGCCAGGCATGG - Intronic
1078545786 11:12246022-12246044 AGAAAGGCAGGGACAAGAGAAGG - Intronic
1078549534 11:12270635-12270657 AGGAAGACAGGGCCAAGCCAGGG - Intergenic
1079122766 11:17697040-17697062 ACAAAGGCAGGGCCCAGACGAGG + Intergenic
1080727923 11:34916275-34916297 AGCCAGACATGGCCCAGACCAGG + Exonic
1080751016 11:35150350-35150372 AGCAAGGCAGGCCTGAGAGATGG + Intronic
1082835342 11:57647070-57647092 AGGCAGGCAGGGCCCGGACCGGG + Exonic
1083332758 11:61906560-61906582 ACCAAGGCCGGGCCCCGAAAGGG - Exonic
1083610450 11:64001758-64001780 AAGAAGGCAGGGCCCAGAGCGGG + Intronic
1083662398 11:64257715-64257737 AGCAAGGCAGGGCTAAGCCCAGG + Intronic
1083717095 11:64583725-64583747 AACAAGGCAGGCCCAGGACAGGG + Intergenic
1083773891 11:64883825-64883847 AGCAGGGCAAGGCCAAGGCAAGG - Intronic
1084089134 11:66868984-66869006 AGCAGGGGAGGGCACAGGCAGGG + Intronic
1084119828 11:67062586-67062608 AGAAAGGCAGGTCCCAGAGTGGG - Intronic
1084269090 11:68019626-68019648 GGCAGGGCAGGGTCCAGGCAGGG + Intronic
1084442097 11:69180416-69180438 AGCCAGGGAGGGCACAGATAAGG - Intergenic
1084563311 11:69916021-69916043 AGCAGGGCAGGGCCGGGGCATGG + Intergenic
1084563515 11:69917149-69917171 AGCAGGGCAGGGCCAGGGCATGG - Intergenic
1084787794 11:71453429-71453451 GGCAAGCCTGGGCCCAGCCACGG - Intronic
1085217473 11:74844997-74845019 AGCAAGTCAGGGTCAAGCCAAGG - Intronic
1085251556 11:75147410-75147432 AGCACGGCAGGGGCTATACAAGG + Intronic
1085345606 11:75766416-75766438 ACCAAGGCCGGGCCCAGAGAAGG + Intronic
1085537070 11:77228206-77228228 AGCCAGGCATGGGCCAGGCAGGG + Intronic
1085912150 11:80840289-80840311 AGCAAGGCAGGAACCAGCCCTGG - Intergenic
1087261079 11:96013478-96013500 AGAAAGGCAGGTCCCTGGCAAGG + Intronic
1088671386 11:112144792-112144814 TCTAAGGCAGGGCCCAGCCAAGG - Intronic
1090071922 11:123551270-123551292 TCCAGGGCAGGGCCCAGAAAGGG + Intronic
1090400961 11:126447944-126447966 AGCAAGGCAGCGCACTGCCATGG - Intronic
1090834029 11:130440760-130440782 AGCAAGCCAGGGCCCAGTCCCGG - Intergenic
1091022950 11:132117371-132117393 AGCAAGGTGGGGCACAGACTAGG - Intronic
1091031255 11:132190301-132190323 AGCAAGGAAGGGCACTGAGAAGG + Intronic
1091339823 11:134801650-134801672 AGCAAGTCAGGGCAGAGAAAGGG + Intergenic
1091584782 12:1809964-1809986 GGCCAGGCAGGGCCCTGAGATGG + Intronic
1091714536 12:2767615-2767637 GGATAGGCAGGGGCCAGACACGG + Intergenic
1091844627 12:3646352-3646374 GGCAAGGGAGGGCACAGCCATGG + Intronic
1092768797 12:11877991-11878013 AGCCACGCAGGGCACTGACAGGG + Intronic
1092879735 12:12878791-12878813 AGGAAGACAGGGCCCATCCAGGG - Intergenic
1093195840 12:16128868-16128890 AGCAAAGCAGTGCCTGGACATGG + Intergenic
1094052590 12:26237697-26237719 AGGAAGGCAGGGCCCAGAATGGG + Intronic
1094691789 12:32776608-32776630 AGCAAGGCTGGGCACAGAATAGG - Intergenic
1096794950 12:54070900-54070922 AGCTGGCCAGGGCCCAGATAAGG - Intergenic
1097363833 12:58688734-58688756 ATGAAGGCAGTGACCAGACAGGG - Intronic
1097490140 12:60257334-60257356 AGGAAAGTATGGCCCAGACATGG + Intergenic
1100339553 12:93665357-93665379 AGCAAGTCAGGGGAAAGACAAGG - Intergenic
1101729425 12:107414649-107414671 AGAAAGGCAGAGACCAGACGAGG - Intronic
1102031097 12:109740601-109740623 AGCAAGGCAGGGACAGGACTGGG - Intronic
1102502804 12:113364219-113364241 AGCAAGGGTGGGCTCAGCCAAGG - Intronic
1103166645 12:118775527-118775549 AATAAGACATGGCCCAGACAGGG - Intergenic
1104131349 12:125897442-125897464 AGCAATGCAAAGACCAGACATGG + Intergenic
1104812765 12:131628575-131628597 TCCCAGGCAGGGCCCAGGCAGGG - Intergenic
1105014859 12:132780313-132780335 AGAGGAGCAGGGCCCAGACAGGG + Intronic
1105214195 13:18274752-18274774 AGAAAGGCAGGGCCCAGAGAGGG + Intergenic
1106086806 13:26550142-26550164 AGCATGATAGGTCCCAGACAAGG + Intergenic
1106610646 13:31276239-31276261 AGTAAGGCCAGGCCCAGAAAAGG + Intronic
1107389926 13:39953226-39953248 GGAGAGGCAGGGCCCAGGCAGGG + Intergenic
1107803375 13:44131473-44131495 GGGAAGGCAGGGTCCAGAGACGG - Intergenic
1112428215 13:99324411-99324433 AGAAAAGCAGGGCCCGGAGAGGG + Intronic
1112432179 13:99359758-99359780 GGCGAGGCAGGGCCCACACAAGG - Intronic
1112497381 13:99915835-99915857 AACATGGCAAAGCCCAGACACGG + Intergenic
1112989565 13:105495577-105495599 AGAAATGCAGTGCCCAGAGAAGG + Intergenic
1113764698 13:112874129-112874151 AGCAAGATGGGGCCCAGGCATGG + Intronic
1115603294 14:34976328-34976350 AGCCAGGCATGGGCCAGACACGG + Intergenic
1115766747 14:36630862-36630884 AATAAGGCAGGGGACAGACAAGG + Intergenic
1116284347 14:42953039-42953061 AGCAAGACAGGGCCCAAAGAGGG + Intergenic
1117572278 14:57059425-57059447 AGCAAGACAGGTCCCACAAAAGG + Intergenic
1121338773 14:93092841-93092863 AGCACGGCAGGGCCCAGGCCAGG + Intronic
1121594150 14:95146740-95146762 AGCCAAGCAAGGCCCGGACACGG + Intronic
1122687820 14:103518382-103518404 AGCCAGGGAGGGCCCAGTCTAGG + Intergenic
1122720956 14:103722069-103722091 AGCAAGCCGGGCCCCAGACCAGG - Intronic
1122969346 14:105146176-105146198 AGCAAGGCAGGACCCAGACCAGG + Intronic
1123119070 14:105908702-105908724 AGCAAGGCAGGTCCCGGGCCTGG + Intergenic
1123121296 14:105918261-105918283 AGGAAGGCAGGTCCCAGTCTTGG + Intronic
1123124911 14:105939650-105939672 ACCAGCGCAGGGCCCAGACCAGG - Intergenic
1124166228 15:27328259-27328281 AGCAAGCCAGGGCGAAGACCTGG + Intronic
1125503994 15:40256440-40256462 AGCATGTCAGGGCCCAGCCCTGG + Intronic
1125670230 15:41466779-41466801 TGCAAGGCAGGGCAAAGAGATGG - Intronic
1125722777 15:41853139-41853161 AGGAAGGCTGGGCGCAGGCAGGG - Intronic
1126321475 15:47428954-47428976 AGCAAGGAAGGGCCGAAAGAAGG + Intronic
1126664054 15:51059863-51059885 AGAGAGGGAGGGACCAGACAAGG - Intronic
1127372822 15:58356528-58356550 AGGGAGCCAGGGTCCAGACACGG + Intronic
1127457981 15:59171961-59171983 AGTCAAACAGGGCCCAGACAAGG - Exonic
1128152057 15:65369315-65369337 AGAAAAGCAAGGCCCAGAGAGGG + Intronic
1128241643 15:66105345-66105367 TGCAAGGCCGGGCCCTGCCATGG + Intronic
1129172653 15:73817521-73817543 AGGAACGGAGGGCCCAGAGAGGG + Intergenic
1129589759 15:76905029-76905051 CGCAGGGCAGGGCCCGGACGCGG + Intronic
1129656730 15:77529584-77529606 GGCAAGCCACGGCCCAGAGAAGG - Intergenic
1129659081 15:77543105-77543127 GGGAAGCCAAGGCCCAGACATGG - Intergenic
1129753116 15:78079882-78079904 AGTCAGACCGGGCCCAGACAAGG + Intronic
1133616234 16:7479462-7479484 AGCAAGGAAGGGCTGAGAAAAGG - Intronic
1134110242 16:11510824-11510846 AGGAAGACAGGGCCAAGCCAGGG + Intronic
1136050155 16:27644488-27644510 AGCAAAGAAGGGCTCAGAGAAGG - Intronic
1136417402 16:30112480-30112502 AGGCAGGCATGGCCCAGGCAGGG + Intronic
1136511943 16:30743593-30743615 AAGTAGGCAGGGCCCAGAGATGG + Intronic
1137613508 16:49834514-49834536 CGCAGGGCAGGGCCCAGCCCTGG - Intronic
1138377901 16:56579240-56579262 AGTAAGGCTGGGCACAGAGAAGG - Intergenic
1138482943 16:57316183-57316205 AAAAAGGCTGGGCCCAGAGAAGG + Intergenic
1139177852 16:64711208-64711230 AGCCAGGCAAGATCCAGACATGG + Intergenic
1139834542 16:69827739-69827761 AGCCAGGCAGGGCCTGGGCAGGG + Intronic
1139971209 16:70776549-70776571 TACAAGGCAAGGCCCAGACTGGG - Intronic
1141611280 16:85182402-85182424 TGAAAGGCAGCACCCAGACAAGG + Intronic
1141627170 16:85267346-85267368 AGGAAGGCAGGGACAAGGCAGGG - Intergenic
1142236315 16:88924228-88924250 AGGAAGGCGGGGCCCAGAGAGGG - Intronic
1142245110 16:88966771-88966793 AGCCAGGCAGGGCCAGGGCACGG - Intronic
1203123904 16_KI270728v1_random:1559954-1559976 ACCGAGGCAGGGCACAGCCAAGG - Intergenic
1142742676 17:1940325-1940347 AGCACGGCTTGGCCCAGAAAGGG - Intronic
1142760116 17:2037083-2037105 TGCAAGGTAGGGACCAAACAGGG + Intronic
1143363091 17:6387327-6387349 GGCCAGGCAGGGGCCAGGCATGG - Intergenic
1144764894 17:17727273-17727295 AGGAAGCCAGAGCCCAGAGAGGG + Intronic
1144783134 17:17817679-17817701 AGCAAGGTTGGGCCCTGCCACGG - Exonic
1144801486 17:17931314-17931336 AGCAAGGCAGAGCACCAACAAGG + Intronic
1145101956 17:20084974-20084996 AGCAGGTCTGTGCCCAGACAAGG + Intronic
1145264525 17:21373381-21373403 AGGAAAGCAAGGCCCAGAGAGGG - Intergenic
1145269943 17:21399514-21399536 AGCACAGCAGGGGCCAAACAGGG + Intronic
1147325063 17:39666143-39666165 AGCCAGGAAGGGCCCAGCCCAGG - Exonic
1147534884 17:41314139-41314161 TGCTAGGTAGGGCCCAGCCAAGG - Intergenic
1148239101 17:45988310-45988332 AGCAAGTCAGAGCTCAGAGAAGG - Intronic
1148645067 17:49215303-49215325 AGAAAGGCAGGAGCCAGACCTGG + Intronic
1149867072 17:60157036-60157058 AGCCAGGCAGAGCCCAAGCAAGG + Intronic
1150057313 17:62030248-62030270 AGCCAGGCAGGGCCAGCACACGG + Intronic
1151103762 17:71588075-71588097 AGAAAGGCAGGGGCCAGACCAGG + Intergenic
1151177132 17:72297940-72297962 AGCAAGCCAGGACTCAGAGAGGG + Intergenic
1151373209 17:73663640-73663662 AGCAAAGCAGGGCAAAGGCAGGG - Intergenic
1151552869 17:74832056-74832078 AGGCAGGGAGGGGCCAGACAAGG + Intronic
1151651815 17:75474954-75474976 AGGGAGGCAGGGCCCAGAGAGGG + Intronic
1151678199 17:75610616-75610638 AGCCAGGGAGGGGCCAGAGAGGG - Intergenic
1151868190 17:76818982-76819004 ATGAAGGCAGAGGCCAGACATGG + Intergenic
1152543119 17:80987027-80987049 AGCAAGGAAGGGGTCAGACAGGG - Intergenic
1152720919 17:81923477-81923499 AGGAAGGCAGGCGCAAGACAAGG + Intronic
1153475732 18:5496594-5496616 AGCAAGGAAGTTCCCAGACTAGG + Intronic
1153659484 18:7314430-7314452 AGCCAGGCATGGGCCAGGCACGG + Intergenic
1157411185 18:47464838-47464860 AGCAAGGGAGGACCCAGCCTCGG + Intergenic
1157586353 18:48803897-48803919 TGCAAGTCAAAGCCCAGACAAGG + Intronic
1158599628 18:58846300-58846322 AGCAAGGGAGGGCAGAGAGATGG + Intergenic
1159691714 18:71496184-71496206 AGGAATGCAGGGGCCAGATAAGG + Intergenic
1160033207 18:75279781-75279803 AGAATGGCAGGGCCCAGCCCGGG - Intronic
1160146299 18:76367672-76367694 AGCAAGGCAGCGCTGTGACATGG - Intronic
1160670073 19:357848-357870 AGCAAAGCACCGGCCAGACATGG + Intergenic
1160796473 19:947995-948017 GGCCAGGCAGAGCCCAGAGAGGG + Intronic
1160826095 19:1081256-1081278 AGCGAGGCAGGGGGCAGACCTGG + Intronic
1160953499 19:1678992-1679014 GGCAGGGCAGGGCTCAGAGAGGG - Intergenic
1161030956 19:2057568-2057590 GTCACGGCAGGGCCCAGCCAAGG + Intergenic
1161567032 19:5008889-5008911 AAAAAGGCAGGGGCCAGGCATGG - Intronic
1161671346 19:5612797-5612819 GGCAGGGCAGGGCCCAAACTCGG - Intronic
1161857427 19:6773606-6773628 AGTAAGGCAGGGCCCAGTCCTGG + Intronic
1162100164 19:8334464-8334486 AGTAAGCCAGGGCCCAGCGACGG + Intronic
1162550950 19:11357825-11357847 AGCAAGGGAGATCCCAGAGATGG - Intronic
1162723233 19:12674715-12674737 AGCAAGGCATGCTCCAAACATGG + Intronic
1163365522 19:16873844-16873866 AGGGAGGCAGAGTCCAGACATGG - Intronic
1163417553 19:17195646-17195668 AGCCAGCCAGGGCCCAGGCTGGG + Intronic
1164181795 19:22825681-22825703 ATGTGGGCAGGGCCCAGACATGG - Intergenic
1164424120 19:28125098-28125120 ACCAAGGCTGGACCCAGACTGGG - Intergenic
1164576014 19:29405655-29405677 AGCAAGGCAGGGCCTGGGCTTGG - Intergenic
1165222228 19:34325729-34325751 ATCAAGGCAGGAGCCAGACTAGG - Intronic
1166374032 19:42316979-42317001 GGGAAGGCAGGGCCCGGCCAGGG - Intronic
1166915904 19:46196082-46196104 AGCGAGACAGGTCCCAGACAGGG - Intergenic
1166925140 19:46261707-46261729 ATCGAGACAGGTCCCAGACAGGG + Intergenic
1167793952 19:51697069-51697091 TCCAAGGTAGGGCCCAGACATGG + Intergenic
1167992846 19:53375302-53375324 CGCCAGGCAGGGCCCAGAATTGG + Intronic
1168469800 19:56630645-56630667 AGCATGGCTGGGACCAGGCAGGG + Intergenic
1168471333 19:56643174-56643196 AGCTCTGCAGAGCCCAGACAGGG + Exonic
925330024 2:3051502-3051524 AGCAAACCACGGCCCAGGCAGGG + Intergenic
925645861 2:6036409-6036431 AGCAAGCCAAGGCTAAGACAAGG - Intergenic
926048157 2:9725249-9725271 AGCAAGGCAGGGCTCGGTAACGG + Intergenic
926224089 2:10955098-10955120 ACCAAGGCTGGGCCCAGGCAAGG - Intergenic
926231047 2:11004199-11004221 ACCAAGGCTGGGCACAGAGAAGG + Intergenic
926263398 2:11290217-11290239 AACAAGGAAGGTCACAGACATGG - Intronic
926823654 2:16880835-16880857 ATCAAGGTAGTGCCCAGGCACGG - Intergenic
929079207 2:38105921-38105943 ATCAAGGCAGGGCCCAGGGAGGG + Intronic
930769885 2:55120392-55120414 GGCAAGGCAGGGCCCAAGCCTGG - Intergenic
931420557 2:62123213-62123235 AGAAAGGCATGGGCCAGGCACGG + Intronic
932576306 2:72964128-72964150 AGCAAGGCAGGTCCCAGCCATGG + Intronic
932716058 2:74101359-74101381 AGTCAGGCTGGGCCCAGCCAAGG - Exonic
933783108 2:85815328-85815350 AACAAGACACGGCCCAGACAGGG + Intergenic
934054219 2:88238592-88238614 GGCAAGGGAAGGCCCAGAGAGGG + Intergenic
934300124 2:91771998-91772020 AGAAAGGCAGGGCCCAGAGAGGG - Intergenic
934677275 2:96258463-96258485 AGGCTGGCTGGGCCCAGACAAGG + Intronic
934975753 2:98800996-98801018 AGCATGGCCTGGCCCAGCCAGGG - Intronic
935037764 2:99395697-99395719 AGCAGGGAAGGGCCTAGATAAGG + Intronic
935841995 2:107123550-107123572 AGCAAGGCAGGTCCCACAGAAGG - Intergenic
936267823 2:111023724-111023746 AGGAAGGCATGGGCCAGACAGGG + Intronic
937096797 2:119240832-119240854 AGGGAGCCAGGGCCCAGACAGGG + Intronic
937245931 2:120493137-120493159 TGCAAATCAGGGCCCAGACAGGG + Intergenic
937943685 2:127311375-127311397 TCCAAGGCAGGTCACAGACAGGG + Intronic
938071800 2:128312309-128312331 AGGAAGTCAGGCCCCAGAGAAGG - Intronic
938297612 2:130188205-130188227 AGCATGGCAGGCCGCAGACTTGG - Intronic
938787594 2:134646733-134646755 AACATGGAATGGCCCAGACATGG - Intronic
940269101 2:151871961-151871983 AGTAAGGCAGGGCCCAAAGGAGG - Intronic
940360677 2:152792741-152792763 AGGAAGCCAAGGCCCAGAGAAGG + Intergenic
940941274 2:159564289-159564311 AGCAAGGCAGAGACCACAGAGGG + Intronic
942248578 2:174028671-174028693 ACCAAGAAAGGGCCAAGACATGG - Intergenic
942528948 2:176887731-176887753 AGGAAGGAAGCTCCCAGACAGGG - Intergenic
943073745 2:183171589-183171611 AGAAAAGCAGGGGCCAGGCACGG - Intergenic
948015748 2:234689386-234689408 AGCATAGCAGGTCCCAGAGAAGG - Intergenic
948099797 2:235364752-235364774 GGGAAGACACGGCCCAGACAAGG - Intergenic
948185989 2:236021766-236021788 AGACAGGCACGGGCCAGACATGG + Intronic
948445184 2:238027036-238027058 ACTAAGGCAGGGACAAGACAGGG - Intronic
948505338 2:238424067-238424089 ACCCAGGCAGGGACCAGAAATGG - Intergenic
949042881 2:241857652-241857674 AGGAAGGCACGGCCCTGACAAGG + Intronic
1168771737 20:420480-420502 AGCAGGGCAGGGCCCGGGCCAGG - Intronic
1168812858 20:717586-717608 CGCAAGGGAGGGCACAGAAAAGG - Intergenic
1168954942 20:1828190-1828212 AGCACTGCTGGGCCAAGACAAGG - Intergenic
1171413987 20:24965262-24965284 GGCAGGGCAGGGCCCAGGCCAGG - Intronic
1172645555 20:36467071-36467093 AGGAAGGCAGGGCCGAGAGAAGG - Intronic
1172677247 20:36681986-36682008 AGTAAGCCAGGGACCAGGCACGG - Intronic
1172877056 20:38170713-38170735 AGCAAGTCAGGGCAGAGTCAGGG + Intergenic
1173706050 20:45111048-45111070 AGATGGGCAGGGCCCAGACCAGG - Intronic
1173860149 20:46277902-46277924 AGGAAGGCAGGGCCGAGGGAGGG + Intronic
1174095693 20:48087947-48087969 AGGAAGGCAGGGCTGAGAGATGG - Intergenic
1174209422 20:48865633-48865655 AGCAAGGGAGGGCCAATACTGGG - Intergenic
1174380784 20:50154023-50154045 GCCGAGGCAGGGCCCAGAAATGG + Intergenic
1174404858 20:50296472-50296494 AACAAGGCAGGGGGCTGACAGGG + Intergenic
1174550657 20:51359222-51359244 AGCCAGGCTGGGCCCTGAGAAGG + Intergenic
1174645837 20:52084798-52084820 GGCAAGGAAGGGCTCAGAGAGGG - Intronic
1174873632 20:54205996-54206018 TGCAAGGCAGGGGCCAGATCTGG - Intergenic
1175212905 20:57372734-57372756 AGCCTGGCAGGACCCAGGCAGGG - Intronic
1175220243 20:57412502-57412524 AGCAAGCCAGGGCTGTGACACGG - Intergenic
1175305658 20:57973967-57973989 GGCAGGGCAGGACCCAGACAAGG - Intergenic
1176155747 20:63619463-63619485 AGCAAGGCAGGGCACAGGGATGG + Exonic
1176218536 20:63959349-63959371 AGCATGGCAGTGGTCAGACAGGG + Exonic
1176310217 21:5145363-5145385 AGCAAGGAGGGGCCCAGGCTGGG + Intronic
1177112793 21:17049107-17049129 AGCCAAGCAAGGCCCAGGCAGGG - Intergenic
1177372101 21:20217940-20217962 AGCCTGGCAGGTCCCAGACAAGG - Intergenic
1177999968 21:28150060-28150082 AGCAAGGGAGAGGCCAGAAAAGG + Intergenic
1178460276 21:32796296-32796318 AGTTAGGCAGGGCCCAGCCTGGG + Intronic
1179846839 21:44116673-44116695 AGCAAGGAGGGGCCCAGGCTGGG - Intronic
1180096960 21:45560237-45560259 AGCCACACAGGGCCCACACAGGG + Intergenic
1181012922 22:20052805-20052827 GGCAGGGCAGGGCCCAGGTAAGG + Intronic
1181042274 22:20197795-20197817 AGCTGGGCAGGGGGCAGACACGG - Intergenic
1181316228 22:21972533-21972555 AGCAAGGGTGGGCAAAGACATGG + Intronic
1181522691 22:23458684-23458706 ATCAGGGCAGGGCCCAGCCCAGG + Intergenic
1181555899 22:23671525-23671547 AGAAAGGCAGGGCCCAGAGAGGG + Intergenic
1181580375 22:23824842-23824864 AGAAAGGCAGGGCTCAGCTAAGG - Intronic
1181594970 22:23908247-23908269 GGCAAGGCAGGGCCCAGGCCTGG + Intergenic
1181698478 22:24607128-24607150 AGAAAGGCAGGGCCCAGAGAGGG - Intronic
1181771162 22:25126664-25126686 AGGAAGCCAAGGCCCAGAGAGGG + Intronic
1182453747 22:30436331-30436353 GGCATGGCAGGACTCAGACAGGG + Intergenic
1182568883 22:31221200-31221222 AGCAGACCAGGGGCCAGACATGG + Intronic
1182768999 22:32780217-32780239 AGCAAAGCACAGACCAGACATGG - Intronic
1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG + Intergenic
1183014196 22:34972622-34972644 AGGAAGGCTAGGCCCAGAGAGGG + Intergenic
1183369293 22:37423361-37423383 AGCAAAGCAAGGCCCAGAAAGGG + Intronic
1183387161 22:37521409-37521431 AGCCAGGCAGGAGGCAGACAGGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183597493 22:38821562-38821584 AGGAAGGCCAGGCCCAGAGAGGG + Exonic
1184257588 22:43295984-43296006 GGCAGGGCAGGGCCCAGACAGGG + Intronic
1184286835 22:43476751-43476773 AGCCAGTGAGGTCCCAGACAAGG + Intronic
1184287064 22:43477745-43477767 AGCCAGTGAGGTCCCAGACAAGG + Intronic
1184617693 22:45649027-45649049 AACAGGGCAGGGCGCAGGCATGG + Intergenic
1185054317 22:48570077-48570099 AGCATGGGAGGGCCCTGCCAGGG - Intronic
950031834 3:9858848-9858870 AGGCAGGCAGAGCCCAGACACGG - Intergenic
950077196 3:10195642-10195664 AGCCAGGCAGGCCTCCGACAAGG + Intronic
950173303 3:10853931-10853953 AGAAAGCCAGGGCCCTGGCAGGG - Intronic
950422170 3:12905661-12905683 AGCAGGCCAGGGCCCAGAGAGGG - Intronic
950572821 3:13812400-13812422 AGCCTGGCTGGGCCCAGGCAGGG + Intergenic
953519216 3:43625130-43625152 TGCAGGGCAGCTCCCAGACAGGG + Intronic
954280111 3:49571267-49571289 AGCAAGTCAGGGGCAGGACAGGG + Intronic
954446005 3:50547266-50547288 AGGGAGGCAAGGCCCAGCCAGGG + Intergenic
954472907 3:50714237-50714259 AGAAAGGGAGTGCCAAGACATGG - Intronic
954545074 3:51426896-51426918 AGCAGGACAAGGCCCAGAAAAGG - Intronic
955467296 3:59250542-59250564 TGCAAGGGATGGCCCAGGCAAGG - Intergenic
956112328 3:65881911-65881933 AGCTAGGCAGTGCCCATCCAAGG + Intronic
956133436 3:66075690-66075712 AGGAAAGCAGGACCCAGAGATGG + Intergenic
956338683 3:68195033-68195055 AGCATGTGAGGACCCAGACATGG - Intronic
960942335 3:122943131-122943153 AGCCGGGCAGGGACCAGGCAGGG + Intronic
961645974 3:128392979-128393001 AGCAAGGCTGGGCTCAGAGGAGG - Intronic
962713923 3:138111023-138111045 ACCAAGGAAGGGCCCATACCAGG + Intronic
963207794 3:142654199-142654221 AGCAAAGCAGAGAACAGACAGGG - Intronic
963295271 3:143538993-143539015 AGCAAGGCACAGCACAAACAAGG + Intronic
964309986 3:155382449-155382471 AAAAAAGCAGGGCCCAGAAAAGG + Intronic
966034250 3:175391387-175391409 ATCAAGGGAGGGCCCACAGAAGG - Intronic
966878708 3:184337839-184337861 AACCAGGCTGGGGCCAGACAGGG + Intronic
967159745 3:186725143-186725165 ATCAACGCAGAGCCCAGACCTGG + Exonic
968221513 3:196943245-196943267 AGGTAGGCTGGGTCCAGACACGG + Intergenic
968288158 3:197520120-197520142 GCCAAGGCAAGGCCAAGACATGG + Intronic
968560656 4:1279653-1279675 AGGACGGCAGGGCTCAGTCACGG - Intergenic
968931505 4:3581851-3581873 AACAAGGCCGGGCACAGGCAGGG + Intronic
969504252 4:7574435-7574457 AGCAAGGCAGGGGCGAGAGCTGG - Intronic
970369857 4:15395651-15395673 AGAAAGGCAGGGCCGAGGGAGGG + Intronic
970652393 4:18193155-18193177 AGCAAGGCAGGGACAGGCCAAGG + Intergenic
971178266 4:24302651-24302673 AGCGAGTCAGGGGCCAGGCAGGG + Intergenic
975530439 4:75394591-75394613 AGAAAGGCAGAGCCCATAGAAGG + Intergenic
978522203 4:109628331-109628353 AGGTAGGCAGAGGCCAGACAAGG + Intronic
978644652 4:110915583-110915605 AGCAAGGCAGAGCAGAGACATGG + Intergenic
980117188 4:128690910-128690932 AGCATGTCAGGAGCCAGACATGG - Intergenic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
981920201 4:150078430-150078452 GGGAAGGAAGGGGCCAGACACGG + Intronic
982953850 4:161737067-161737089 AGCAAGGAAGGGCAGAGACCAGG + Intronic
984983351 4:185303681-185303703 AGCAAGGCAGGGCACACAGTGGG + Intronic
985040155 4:185883110-185883132 AGAAAGGCAAGCCACAGACAGGG + Intronic
985478072 5:91057-91079 ATCAAGGCGGGGCGCAGCCAGGG + Intergenic
985762522 5:1757610-1757632 AGCTGGGCAGGGGCCAGGCAGGG - Intergenic
985774706 5:1834849-1834871 AGCAAGGCATGGCACAGCCTTGG + Intergenic
985888061 5:2695495-2695517 ACCAAGGCATGGGCCAGGCAGGG + Intergenic
986111977 5:4728298-4728320 GGCAAGGAAGGGCCCTGCCATGG + Intergenic
986757844 5:10854665-10854687 AGCACTGCAGGGCAGAGACAAGG + Intergenic
990584858 5:57200966-57200988 AGCCAGGCATGGGCCAGGCATGG - Intronic
990636341 5:57732069-57732091 AGCAAGACATGGACCAGAAAGGG + Intergenic
991634101 5:68686009-68686031 AGAGAGGCAGGGCTCAGGCATGG - Intergenic
991978808 5:72210691-72210713 AGACAGGCAGGGCCCAGTCTTGG - Intergenic
992176563 5:74154977-74154999 TGCAAGACAAGGACCAGACATGG + Intergenic
992522480 5:77569001-77569023 AGAAAGGCAGGGCACAGCGATGG - Intronic
993860023 5:93124739-93124761 GGAAAGCCAGGGCCCAGCCAAGG + Intergenic
996026188 5:118648496-118648518 ATCAAGGGAGGGCACAGAGAAGG + Intergenic
996058899 5:119011293-119011315 AGCACGGCTGGGCCCAGTCCTGG + Intergenic
996059981 5:119022495-119022517 AGGAAGGGAGGGGCCAGGCATGG + Intergenic
996755157 5:126927491-126927513 AGGCAGGCAGGTCCCAGCCAGGG - Intronic
997208167 5:132062430-132062452 GGCAGGGCAGGGCCAACACAGGG - Intronic
997736495 5:136216287-136216309 AGCAAGGAAGGGATCAGACAGGG + Intronic
999373180 5:151068648-151068670 AGCAAGGCAAGGCCCTGAGCAGG + Intronic
1000138744 5:158380945-158380967 AGGAAGGCAGGACTCAGTCACGG - Intergenic
1001772272 5:174305370-174305392 AGTAAGGCAGGGCACCCACAGGG + Intergenic
1001961411 5:175882292-175882314 AGACAGGCAGGGCCCAGTCCAGG + Exonic
1002417797 5:179129900-179129922 AGCAGGGCTGGGCCCAGGGAAGG - Intronic
1002644573 5:180646845-180646867 CACATGGCTGGGCCCAGACAGGG - Intronic
1003364472 6:5459154-5459176 AGTAATGCAGGTCCAAGACACGG - Intronic
1006301133 6:33193939-33193961 GGAAAGGCAGGGCCCTGAAATGG - Exonic
1006389365 6:33749510-33749532 AGCAAGGTGGGTCACAGACATGG - Intergenic
1007153443 6:39718451-39718473 AGCAAAGCAGGGGCCAGGCGCGG + Intronic
1007401675 6:41606101-41606123 GGAAAGGCAGGCACCAGACAGGG + Intergenic
1007733944 6:43968713-43968735 GGCAAGGCAGGGAGCAGACAAGG + Intergenic
1007743825 6:44029999-44030021 AGCAAGGCGGGTCCCAGCCTTGG - Intergenic
1008482194 6:51997234-51997256 TGCAAGGCAGGGAAGAGACATGG + Intronic
1011399896 6:86948919-86948941 AGGAAGGAAGAGCCCAGAGATGG + Intronic
1017075399 6:150613024-150613046 AGCAGAGCAGGGGCCAGACTAGG - Intronic
1017134210 6:151134070-151134092 TGCAAGGCAGGGCAGAGACGTGG - Intergenic
1019053138 6:169200123-169200145 CGCAAGGCAGGGTCCAGCTATGG - Intergenic
1019164781 6:170091079-170091101 AGCAGGGCAGGGGGCAGACCAGG - Intergenic
1019509873 7:1412491-1412513 AGCCAGGCAGGCCCGAGGCAGGG - Intergenic
1019791037 7:3014135-3014157 AGCCAGGCAGGGCCTGGAGAGGG + Intronic
1022186021 7:27969826-27969848 ATCAAGGCATGGCCAAGGCAAGG - Intronic
1022643148 7:32206740-32206762 AGCATGGCAGTGCCCACACCCGG + Intronic
1023493124 7:40765704-40765726 ACCAAGGGAAGGCCCATACAGGG + Intronic
1024556731 7:50610134-50610156 AGGAAGGCAGAGCACACACACGG + Intronic
1025204957 7:56987178-56987200 AGCACGGCAGGGCACTCACAGGG + Intergenic
1025666981 7:63589757-63589779 AGCACGGCAGGGCACTCACAGGG - Intergenic
1025923422 7:65936708-65936730 AGCAAGGAAAGGACCAGAGAAGG - Intronic
1027215090 7:76178549-76178571 AGCAAGGCAGAGACCAAGCACGG + Intergenic
1029174654 7:98656030-98656052 AACATGTCAGGGCCCAGGCATGG + Intergenic
1029187762 7:98751940-98751962 AGACAGCCAGGCCCCAGACAAGG + Intergenic
1029595711 7:101536559-101536581 AGGCAGGCAGATCCCAGACAGGG + Intronic
1029633519 7:101768443-101768465 AGAAAGACAGAGCCCAGAGAGGG + Intergenic
1030059922 7:105614081-105614103 CGCAAGGGAGGGCACAGAGAGGG + Exonic
1031515771 7:122696410-122696432 AGCAAGGCATGGCTCACACCTGG + Intronic
1032540025 7:132695136-132695158 AGCCAGGCAGGGGACAGACAGGG - Intronic
1032711320 7:134463003-134463025 AGCAAGGCACAGTCCAGAAATGG - Intergenic
1033214420 7:139483341-139483363 ACCAAGGCAGGGCCCGGTGACGG + Exonic
1033245326 7:139712852-139712874 ACCACTGCAGGGCTCAGACAAGG + Intronic
1033344941 7:140519319-140519341 AGCATGGCGGGAACCAGACAAGG - Intronic
1034524325 7:151647223-151647245 AGCAGGCCAGGCCCCAGGCAAGG - Intronic
1035224423 7:157425564-157425586 ACCCAGGCAGGGTCCAGACGGGG - Intergenic
1035766301 8:2108554-2108576 GACAAGGCAGGGCACAGTCATGG - Intronic
1036769730 8:11570800-11570822 AGGAAGCTAGGGCCCAGAGAGGG + Intergenic
1036949010 8:13123250-13123272 AGGCAGGCAGGGTCCTGACAGGG - Intronic
1039047867 8:33466533-33466555 GGCAGGGCAGGGCCCAGCCAGGG + Intronic
1039895856 8:41715922-41715944 AGCAAGGCAGGGCCCAGAGAGGG + Intronic
1040866854 8:52056261-52056283 AGCAAGGCTGGGCTCACACACGG - Intergenic
1042687854 8:71462018-71462040 ACCATGGCTGGGCCCAGAAAAGG + Intronic
1042855137 8:73259529-73259551 AACAAGGCACGTCCGAGACAAGG + Intergenic
1047586699 8:126281140-126281162 AGCAAGGAAGTGCCCAGATTGGG + Intergenic
1047685777 8:127303472-127303494 AGCAAGGCAGGGAACGGGCAGGG + Intergenic
1047784287 8:128138641-128138663 AACAAGGCAAATCCCAGACAAGG - Intergenic
1049338012 8:142096762-142096784 GGCGAGGCAGGGTCCAGGCAGGG + Intergenic
1049422679 8:142523904-142523926 AGCCAGGAAGGGCCCAGGCCTGG + Intronic
1049434740 8:142581293-142581315 AACTAGGCTGGGCCCAGCCATGG + Intergenic
1049558827 8:143297222-143297244 AGGAAGGGGGCGCCCAGACAGGG + Exonic
1051553411 9:18355937-18355959 AGCCAAGCAAGGCCCAGGCAGGG - Intergenic
1051632115 9:19150030-19150052 AGCCAGGCATGGGCCAGGCATGG + Intergenic
1053067730 9:35079973-35079995 AGCGAGGAAGGGCCGAGCCACGG - Exonic
1053304152 9:36972264-36972286 AGCATGGCAGGGCCGTGGCAGGG + Intronic
1054458623 9:65450078-65450100 AACAAGGCTGGGCACAGGCAGGG - Intergenic
1056426844 9:86485981-86486003 CACAAGGCAGGACCCAGAAAGGG - Intergenic
1056753757 9:89369466-89369488 GTGAAGGCAGGGCCCTGACAGGG + Intronic
1056824574 9:89867943-89867965 GGCAAGGCAGGGAGCAGGCAGGG - Intergenic
1057401428 9:94726766-94726788 AGGAAGGCAGGGACCCAACAGGG - Intronic
1057906874 9:98990229-98990251 AGCAAACCAAGGCCCAGATAGGG + Intronic
1057920972 9:99096626-99096648 AGCCAGGCAGGCAGCAGACAAGG + Intergenic
1058644359 9:107116816-107116838 AGCCAGACATGGCCCAGACCAGG - Intergenic
1059301489 9:113317208-113317230 AATAAAGCAGGGCCCAGGCAGGG + Intronic
1059800159 9:117742057-117742079 GGAAAAGCAGGGCCCAGAGAAGG - Intergenic
1060776036 9:126375545-126375567 AGCACGCCCAGGCCCAGACAGGG - Intronic
1061078811 9:128357735-128357757 AGCCAGGGAGGGCCCAGAAGAGG - Intronic
1061137178 9:128741662-128741684 GGCAGGGCAGGGCTCAGCCAAGG + Intronic
1061489613 9:130937957-130937979 AGGAAAGCAGGGCTCAGAGATGG - Intronic
1061590611 9:131595219-131595241 ACCAGGGCAGGGCCCAGACCTGG - Intronic
1061893204 9:133633541-133633563 TGCAAGGAAGGGCGCAGCCACGG + Intergenic
1061957370 9:133970599-133970621 AGCAAGGCTGGGCCCAGGGAAGG - Intronic
1062020923 9:134319139-134319161 AGCATCGCAGGGCAGAGACATGG + Intronic
1062032157 9:134366569-134366591 AGCACCACAGGGCCCAGCCAGGG + Intronic
1062137664 9:134938246-134938268 GTCAGGGCAGGACCCAGACAGGG + Intergenic
1062406773 9:136400366-136400388 CTCAAGGCAGGGGACAGACAGGG + Intergenic
1062452257 9:136620684-136620706 AGCACGCCAAGGCCCAGAGAAGG + Intergenic
1062648617 9:137564092-137564114 AGCATGGGAGAGCACAGACAAGG + Intronic
1186143056 X:6597312-6597334 AGCAAAGCAGGGCCATGATAAGG - Intergenic
1186832024 X:13400270-13400292 AGCAAGTCTGGGCCCAGTCATGG - Intergenic
1188497292 X:30793883-30793905 AGCAAGGCAAGGCCAAGGCCAGG - Intergenic
1188497386 X:30794567-30794589 GGCAAGGCAAGGCGCAAACAAGG - Intergenic
1188497388 X:30794583-30794605 GGCAAGGCAAGGCACAGGCAAGG - Intergenic
1188497647 X:30796344-30796366 GGCAAGGCAAGGCCAAGGCAAGG - Intergenic
1188497987 X:30798771-30798793 GGCAAGGCAAAGCACAGACAAGG - Intergenic
1188498308 X:30800966-30800988 AGCAAGGCAATGCCCAAGCAAGG - Intergenic
1188498348 X:30801248-30801270 GGCAAGGCAAGGCACAAACAAGG - Intergenic
1188498450 X:30801892-30801914 AGCAAGGCAATGCCCAAGCAAGG - Intergenic
1188563594 X:31499101-31499123 AGAGAGGTAGGGCTCAGACATGG + Intronic
1190104340 X:47548380-47548402 AGCCAGGCATGGGCCAGGCACGG + Intergenic
1190375574 X:49785342-49785364 AACAGGGCAGGGTCCAGGCAGGG - Intergenic
1194778748 X:97997159-97997181 ATCTAGGCTGGGCCCAGATAAGG - Intergenic
1195373386 X:104201916-104201938 AGCAAGGAAAGGGCCAGGCATGG - Intergenic
1196751100 X:119118123-119118145 GGCAATGAAGGGTCCAGACAAGG + Intronic
1197108401 X:122743243-122743265 AGTAAGAAATGGCCCAGACATGG + Intergenic
1198372497 X:136004377-136004399 AGGTAGGCAGGGGCCAGGCATGG - Intronic
1198680050 X:139171543-139171565 AGCAGGGCAGAGCCCTGACTGGG - Intronic
1199594994 X:149499989-149500011 AGCAAGGCAGGGCTGTGAAAAGG - Intronic
1200055405 X:153457403-153457425 CCCAAGGCAGGGACCAGGCAGGG - Intronic
1201349835 Y:13027619-13027641 ACCAAGGGAAGGCACAGACAGGG + Intergenic