ID: 1078088713

View in Genome Browser
Species Human (GRCh38)
Location 11:8250726-8250748
Sequence CAGCAGAGGCTGCATCCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078088713_1078088717 30 Left 1078088713 11:8250726-8250748 CCAGTCGGATGCAGCCTCTGCTG 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1078088717 11:8250779-8250801 CAGAAACACTCAGCTGAGAAAGG 0: 1
1: 0
2: 3
3: 32
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078088713 Original CRISPR CAGCAGAGGCTGCATCCGAC TGG (reversed) Intronic
900997031 1:6128315-6128337 CAGCAGGGGCTGCAGCTGAGAGG + Intronic
901039910 1:6357628-6357650 CAGCAGAGGCTGCCTTGGCCAGG + Intronic
903261015 1:22131949-22131971 CAGCAGAGGCTGCATTTGGAAGG + Intronic
903966680 1:27095016-27095038 CAGAAGAGGCTGCATTGCACAGG + Intergenic
904084433 1:27894999-27895021 CAGCAGTGTCTGCTTCCGAGAGG - Intronic
904373750 1:30066619-30066641 CAGCAGGGGCTGCACCCCATGGG - Intergenic
904565178 1:31424548-31424570 CAGCAGGGGCTGGACCAGACAGG - Intronic
905923514 1:41734119-41734141 GAGCAGAGGCTGCACCCACCAGG + Intronic
913214007 1:116604782-116604804 CAGCAGAGGCTAGATGAGACAGG - Intronic
915471214 1:156126795-156126817 CAGGAGTGGCTGCATCCCAGTGG - Intronic
915474845 1:156147363-156147385 CAGCAGAGTCTGCACCGGACAGG - Intronic
915996571 1:160570016-160570038 AAGGAGAGGCTGCATCAGAGAGG + Intronic
916743922 1:167669859-167669881 CAGGAGAGGCTACAGCTGACTGG + Intronic
916802335 1:168226498-168226520 CAGCAAAGGCTCCTTCCGCCTGG - Intronic
917114555 1:171589463-171589485 CAGCGGAGGAGGCATCTGACTGG - Intronic
919767324 1:201135777-201135799 CAGCAGCTGCTGCATCCCTCGGG - Exonic
920182147 1:204138545-204138567 CAGCAGAGGCTCCATCACCCTGG + Intronic
1064027965 10:11864084-11864106 CTGCAGAGGCTTCCTCAGACAGG + Intronic
1064439737 10:15343009-15343031 CACAAGAGGCTGCAGCCGAGTGG + Intronic
1065922194 10:30402554-30402576 CAGCAGAGGCTGCAGACTGCGGG + Intergenic
1067685670 10:48464980-48465002 CAGCACAGGGTGCCTCCCACAGG - Intronic
1067755717 10:49002726-49002748 CAGCAGAGGGTGCAGCCAGCAGG + Intergenic
1069856133 10:71442300-71442322 CAGCACTGGCTGCTTCAGACAGG - Intronic
1071991339 10:91103326-91103348 AAGCAGAGGCTGGATCCAACTGG + Intergenic
1072724030 10:97800581-97800603 CAGCAGATGCTACATCTGGCAGG + Intergenic
1076007197 10:126957020-126957042 GGGCACAGGCTGCACCCGACGGG + Intronic
1076519572 10:131073275-131073297 CCGCAGAGGCAGCACCAGACTGG - Intergenic
1078088713 11:8250726-8250748 CAGCAGAGGCTGCATCCGACTGG - Intronic
1078266496 11:9759114-9759136 CAGCAGAGGCTTCACCAGAGTGG - Intergenic
1080281481 11:30562423-30562445 CATCACAGGCTGCCTCCTACGGG + Intronic
1080580842 11:33642482-33642504 CAGCAGAGGCCACATGCGTCAGG - Intronic
1080606647 11:33869671-33869693 CAGCAGCAGCTGCAGCCGCCTGG - Intronic
1083384686 11:62298902-62298924 CAGAAGAGGGTGCATCCCAGGGG + Intronic
1083576765 11:63797545-63797567 CAGCAGAGCCTGCATAGAACTGG + Intergenic
1083969776 11:66067809-66067831 CTGCAGAGGCTGCATCCTTGGGG + Intronic
1084926113 11:72513036-72513058 CATCAGAGGCTGCACACTACAGG - Intergenic
1085507133 11:77067012-77067034 GAGCGGAGGCTGCAGCCGCCCGG - Exonic
1089625872 11:119750521-119750543 GAGCAGAGGCTGCATCTGGATGG + Intergenic
1089688837 11:120173461-120173483 CAGCAGAGGCTGGAGCAGATGGG - Intronic
1090395158 11:126414066-126414088 CAGCAGAGTAGGCAACCGACAGG - Exonic
1090603550 11:128397312-128397334 CAGCAGAGGCTGCAGACCAGAGG + Intergenic
1096840041 12:54374533-54374555 CAGCAAAGGCTGGATCCTAGGGG - Intronic
1105217228 13:18295333-18295355 CAGCAGAGGCTAGATGAGACAGG - Intergenic
1106324322 13:28673483-28673505 GAGCAGAGGCAGCATTGGACAGG - Intronic
1108741279 13:53341308-53341330 GAGCTGAGGCTGCATTCCACAGG - Intergenic
1113535074 13:111059554-111059576 CAGCAGGGGCTGTGTCCGTCAGG - Intergenic
1118284721 14:64461142-64461164 CAGAGGATGCTGCATCCCACTGG + Intronic
1118672549 14:68145284-68145306 CATCAGAGACTGCATCCTACTGG + Intronic
1119897365 14:78231467-78231489 CAGCAGAGACTGCAGCCATCAGG - Intergenic
1122093298 14:99353906-99353928 CAGCAGATGCTGCATCCACCAGG - Intergenic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1125283982 15:38072907-38072929 CAACAGAGGCTGTATGCGAGAGG - Intergenic
1125537785 15:40452572-40452594 AAGCAGAGGCTGCCTGGGACAGG - Intronic
1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG + Exonic
1131617478 15:94031966-94031988 CAACTGAGGCTGGATCCCACTGG - Intergenic
1132320438 15:100920870-100920892 CAGCAGAGGCTGGATCAGCTGGG - Intronic
1133203284 16:4217814-4217836 CAGCAGAGCCAGCTTCGGACAGG + Intronic
1140110297 16:71998375-71998397 CAGCAGACGTTGCAGCCAACGGG - Exonic
1140789991 16:78382378-78382400 CAACAGAGGCTCCATCCACCTGG + Intronic
1141444206 16:84047665-84047687 CAGCAGAGGCTGGATCCCTCAGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142574075 17:894695-894717 CTGCAGAGGCTGCCCCCGGCAGG - Intronic
1142640140 17:1280769-1280791 CAGCAGAGGTTGCACCGGACGGG + Intronic
1148161792 17:45454323-45454345 CAGCAGAGGCTGCCTTGGGCAGG - Intronic
1150393026 17:64800968-64800990 CAGCAGAGGCTGCCTTGGGCAGG - Intergenic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1151457986 17:74238034-74238056 CAGCAGAGGCTACAGAGGACAGG + Intronic
1152922155 17:83071495-83071517 CAGCAGTGGCTGCAGCCACCAGG - Intergenic
1155087570 18:22473025-22473047 CAGCTGAGGCGCCATCCCACTGG + Intergenic
1157569446 18:48702941-48702963 CAGCAGAGGCTTCCTCCTGCTGG - Intronic
1160573628 18:79835230-79835252 CAGCAGAGCCAGCATCTGAGAGG + Intergenic
1160993625 19:1871902-1871924 CAGCAGGGGCAGGATCCGGCTGG + Intergenic
1161866679 19:6837430-6837452 CAGCAGAGGCTGGAGTGGACAGG - Intronic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1163294829 19:16405309-16405331 CATCAGAGGCTGCACCCCACAGG + Intronic
1163946931 19:20546309-20546331 CATGAGCGACTGCATCCGACTGG - Intronic
1164852992 19:31500255-31500277 CATCAGAGCCTGGATCCGGCTGG - Intergenic
1166348835 19:42184401-42184423 GAGCAGAGGCTGCTTCCTAATGG - Intronic
1166959613 19:46489667-46489689 CAGCACAGGCTGCAGCAGCCGGG - Intronic
1167486991 19:49768306-49768328 CTTCAGAGGCTGCATCCGCATGG + Intronic
927084321 2:19659490-19659512 CAGCAGCGGCAGCATCCAGCAGG - Intergenic
927437642 2:23083989-23084011 CATCAGAGGCTGCATCCTTGGGG - Intergenic
932302449 2:70676770-70676792 GAGCAGAGGCTGCCCCTGACTGG - Intronic
934297096 2:91751350-91751372 CAGCAGAGGCTAGATGAGACAGG + Intergenic
935196524 2:100819870-100819892 CAGCAGAGGCTGCGGCGGCCTGG + Intergenic
935696947 2:105778307-105778329 CAGCAGAGGCTGGAGCCTTCAGG + Intronic
940423923 2:153509402-153509424 CCGCAGCGGCTGCTTCAGACGGG + Intergenic
944445376 2:199783650-199783672 CAGGAGAGGCTGTATGGGACAGG - Intronic
945201381 2:207285182-207285204 CTGCAGAGGCTGGATCCCATTGG - Intergenic
946722845 2:222629130-222629152 CTGCAAAGCATGCATCCGACAGG + Intronic
947850998 2:233288065-233288087 CAGCACAGCCGGCACCCGACTGG + Intronic
947872589 2:233447712-233447734 CAGCAGAGGCTGTTTCCACCTGG - Intronic
948516870 2:238509635-238509657 CAGGAGAGGCTGCAGCAGCCAGG - Intergenic
948783095 2:240336998-240337020 GAGCAGAGGCTCCAGCAGACAGG + Intergenic
948972786 2:241442097-241442119 CAGCAGGCGCTGCATCCGGCTGG - Intronic
1170551782 20:17483222-17483244 CAGAAGAGGCTCCATACAACTGG - Exonic
1170552337 20:17488749-17488771 CAGCTGGGGCTCCATCCCACTGG - Intergenic
1170627039 20:18037766-18037788 CAGCGGAGGCTCAATCCCACTGG - Intronic
1171481490 20:25458786-25458808 CAGCAGAGTCTGGGTCTGACAGG - Intronic
1171968601 20:31549281-31549303 CAGCACTGGCTGCATCCTGCTGG + Exonic
1172780365 20:37433191-37433213 CAGCAGAGGCTTCATCAAAGGGG - Intergenic
1172986808 20:38998025-38998047 CAGCAGTGGCTGCAGCCGGGAGG + Intronic
1174768068 20:53272383-53272405 GGGCAGGGGCTGCATCTGACTGG + Intronic
1174777980 20:53363141-53363163 CAGCAGAGGCTCATTCCCACTGG - Intronic
1177015642 21:15783537-15783559 CAGCAGAGACTGCACAAGACAGG + Intronic
1178216011 21:30598980-30599002 CAGCAGAGGTAGCATACCACTGG + Intergenic
1179563065 21:42228954-42228976 CAGGAGGAGCTGCATCCCACTGG + Intronic
1179591481 21:42412191-42412213 CAGGAGAGGCTGCGTCTGGCTGG + Intronic
1182360245 22:29742279-29742301 CAGCAGTGGCTCCAGCTGACTGG - Intronic
1182609886 22:31538546-31538568 CAGTAGAGGCTGCAGCAGTCAGG - Intronic
1183723232 22:39574299-39574321 CAGCAGCGGCTGCAGCCACCGGG - Intronic
1184835005 22:47015910-47015932 AAGCAGAGGCTGCATTCCCCAGG - Intronic
1184984644 22:48121463-48121485 GAGCAGAGGCTGCACCTGAATGG + Intergenic
1185055453 22:48576391-48576413 CCGCGGAGGCTGCACCCGGCGGG + Intronic
1185236430 22:49716237-49716259 CAGCAGAGACTGGATCCCACTGG + Intergenic
950454660 3:13085537-13085559 CAGCAGAGCCTGCAGGAGACGGG + Intergenic
951799575 3:26580651-26580673 CAGCAGATGCTCCATCCCACTGG - Intergenic
952005227 3:28835839-28835861 CAGCAGTGGCTGCAGCAGCCTGG - Intergenic
953089467 3:39709458-39709480 CAGCAGAATCTGCATCTGGCAGG + Intergenic
954447541 3:50554708-50554730 CAGCAGAGGCTGCAACATCCTGG + Intergenic
955318237 3:57956576-57956598 CAGCAGAGGCTCCATCACCCTGG - Intergenic
956872091 3:73428137-73428159 CAGAAGAGGCTGGATCTCACAGG + Intronic
957867168 3:86039931-86039953 CAGCAGAGGCTGCAGACCAGCGG - Intronic
961617522 3:128194407-128194429 CAGCAGTGGCTGGATGGGACTGG + Intronic
963107536 3:141659899-141659921 CAGCAGGAGCTGCAGGCGACAGG - Intergenic
964687800 3:159416849-159416871 TACCTGAGGCTGCATCAGACAGG + Intronic
968603817 4:1522214-1522236 CAGCAGAGGCCGCATCCGGAGGG + Intergenic
968734517 4:2288450-2288472 CAGCAGCGCCTGCCTCCGAGGGG + Intronic
969037364 4:4265479-4265501 CAGCAGAGCATCCATCCCACAGG - Intergenic
969508883 4:7605845-7605867 CAGCAGAGGCTGCAGCCAGTGGG + Intronic
969925534 4:10582201-10582223 TAGCAGAGGCTGGATCCTCCTGG - Intronic
970092144 4:12421745-12421767 CAGCAGAGGCTACCTGCGTCAGG + Intergenic
972072466 4:35038554-35038576 CAGCTGAGGCTGCATGCTCCAGG + Intergenic
975960072 4:79891964-79891986 CAGCAGTGTCTGTATCAGACTGG + Intergenic
976704606 4:88007744-88007766 CTGCTGAGGCTGCACGCGACTGG - Exonic
980996172 4:139781943-139781965 CAACAGAGGCTGAATTGGACTGG + Intronic
981941291 4:150284104-150284126 CAGCAGGGTCAGCATCCCACAGG - Intronic
985563303 5:602766-602788 CAGCAGAAGCTGGAGGCGACGGG - Intergenic
992089960 5:73307897-73307919 CTGTAGAGGCTGCATCTGACTGG + Intergenic
992528103 5:77630668-77630690 CAGCGGCGGCGGCAGCCGACGGG + Exonic
995492520 5:112707804-112707826 CAGCAGGAGCTGCGTCCGGCAGG + Intronic
996710791 5:126541621-126541643 CAGCAGAGGCGACACCTGACAGG + Intergenic
1006373083 6:33657365-33657387 CAGCAGTGGATCCATCAGACTGG + Intronic
1011441599 6:87392794-87392816 CAGGAGAGGCTGCAACAGGCTGG + Exonic
1013590952 6:111619294-111619316 CAGGGGAGCCTGCTTCCGACTGG + Intergenic
1015135063 6:129859404-129859426 CAGCAAAGGCTCCGTCCTACTGG + Intronic
1016088154 6:139941488-139941510 CAGCAGAGTCTTCATAGGACAGG + Intergenic
1017608805 6:156162478-156162500 CAGCAGAGGCTGGAAGAGACAGG + Intergenic
1019262213 7:87962-87984 GAGCTGAGTCTCCATCCGACTGG - Intergenic
1020006916 7:4788156-4788178 CAGCACCGGCTGCATCCGAGAGG + Exonic
1022106223 7:27199717-27199739 CAGCAGCGGCGGCAGCCGACGGG + Exonic
1023871990 7:44268309-44268331 GAGCAGAGGCTGCAGCCACCAGG - Intronic
1025257963 7:57398510-57398532 CAAGAGAGGCTGCATCCAACAGG + Intergenic
1025729846 7:64099870-64099892 TGCAAGAGGCTGCATCCGACAGG + Intronic
1033131781 7:138751244-138751266 CTGCAGAGCCTGCCTCCCACCGG + Intronic
1034433289 7:151051413-151051435 CTGCGGAGGCTGCCTCCGCCCGG - Intronic
1034462770 7:151207202-151207224 AAGCAGAGGCTGCATGAGACAGG + Intergenic
1034471538 7:151257305-151257327 CAGCGGGAGCTGCATCTGACAGG - Intronic
1035355281 7:158272916-158272938 CAGCAGAGTCTGCATGCACCGGG - Intronic
1043702973 8:83313431-83313453 CAGCAGAGGCTGCTCCAGATGGG + Intergenic
1045493169 8:102685960-102685982 AAGCAGAGGCTGTATGCCACTGG - Intergenic
1045524983 8:102933873-102933895 CAGCAGAGGCCTCAGCTGACTGG + Intronic
1046628907 8:116604144-116604166 AAGCAGAGGCTGCATCACAGAGG + Intergenic
1050016449 9:1239008-1239030 CAGCTGAGGCTTAATCCCACTGG - Intergenic
1056755856 9:89381690-89381712 CAGCAGAGGATGCATGAGCCTGG + Intronic
1057516692 9:95728341-95728363 CAGCAGCGGCAGCCTGCGACAGG + Intergenic
1057596463 9:96418905-96418927 CAGCAGAGACTCCAGCCGCCGGG - Intergenic
1061022198 9:128023144-128023166 TAGCAGAGGCTCCATCAGCCAGG + Intergenic
1061733679 9:132637178-132637200 CAGCAGAGGCTCCATCTCCCTGG + Intronic
1062397174 9:136357201-136357223 CAGCAATGGCTGCACCCCACAGG - Intronic
1188002531 X:24995653-24995675 CGGCGGGGGCTGCATCTGACTGG + Intronic
1195304112 X:103562346-103562368 CAGCAGAGGCTCCATCCACAGGG + Intergenic
1195454373 X:105051477-105051499 CAGCTGCAGCTGCATCCGAGAGG + Intronic
1195620467 X:106949605-106949627 CATCAGAGGCTGCATAATACAGG - Intronic
1198704763 X:139436528-139436550 CAGCAGAGGCTGCAGAAGAGCGG - Intergenic
1200150007 X:153946726-153946748 CAGAAGAGGTCGCATTCGACAGG + Intergenic