ID: 1078088899

View in Genome Browser
Species Human (GRCh38)
Location 11:8251631-8251653
Sequence AATCCAGCAGCCCCCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078088897_1078088899 -7 Left 1078088897 11:8251615-8251637 CCATCTGTGAGAAAAAAATCCAG 0: 1
1: 0
2: 2
3: 23
4: 408
Right 1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115
1078088896_1078088899 7 Left 1078088896 11:8251601-8251623 CCTTGGAAAACTGACCATCTGTG 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115
1078088895_1078088899 11 Left 1078088895 11:8251597-8251619 CCAGCCTTGGAAAACTGACCATC 0: 1
1: 0
2: 0
3: 6
4: 150
Right 1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115
1078088894_1078088899 12 Left 1078088894 11:8251596-8251618 CCCAGCCTTGGAAAACTGACCAT 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115
1078088893_1078088899 15 Left 1078088893 11:8251593-8251615 CCTCCCAGCCTTGGAAAACTGAC 0: 1
1: 0
2: 3
3: 16
4: 190
Right 1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115
1078088892_1078088899 16 Left 1078088892 11:8251592-8251614 CCCTCCCAGCCTTGGAAAACTGA 0: 1
1: 0
2: 3
3: 67
4: 722
Right 1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078088899 Original CRISPR AATCCAGCAGCCCCCGGCGC TGG Intronic
901426090 1:9183005-9183027 ACCCCTGCAGCCCGCGGCGCCGG - Intergenic
901669806 1:10849605-10849627 AACCCTGCAGCCCCCGGGGCAGG - Intergenic
901927924 1:12578791-12578813 AGTCCAGCAGCCCCAGGGTCAGG + Exonic
903745200 1:25582010-25582032 AATCCAGCCCCACCCAGCGCAGG + Intergenic
904336274 1:29800382-29800404 AATCCTGCAGCCCCAGGTCCTGG - Intergenic
904376730 1:30086365-30086387 AGGCCAGCGGCCCCCGGAGCAGG - Intergenic
904684119 1:32248463-32248485 CATCCAGCAGCTCCTGGTGCAGG - Exonic
906214581 1:44031306-44031328 CATGCTGCAGCCCCCGGCCCAGG + Intronic
910758880 1:90716904-90716926 CAGCCAGCAGCCGCCGCCGCCGG - Exonic
917472487 1:175337528-175337550 AATCCAGCCGCCCCCGTCGGTGG + Exonic
918388723 1:184036921-184036943 GATCCGCCAGCCACCGGCGCGGG + Intronic
920398606 1:205663391-205663413 AGTCCAGCAGCCCCACGCCCAGG + Exonic
922096889 1:222450302-222450324 AATGCTGCAGCCCCCGCCCCTGG - Intergenic
923129037 1:231058861-231058883 AATTCAGCTTCCCCCAGCGCTGG - Intergenic
923163624 1:231338648-231338670 TTTCCTGCAGCCCCCGGCCCTGG + Intronic
923218906 1:231875329-231875351 GAGCCACCAGCCCCCGGCCCTGG + Intronic
923409667 1:233694519-233694541 AATCCAGCAGCACCCATCTCTGG - Intergenic
1065636697 10:27742342-27742364 AACCCAGGAGGCTCCGGCGCAGG - Intronic
1067716013 10:48691511-48691533 ACTCCAGCAGCCCGCTACGCTGG - Intronic
1070756842 10:78998585-78998607 AATCCAGCAGCCCCCGGGAGAGG + Intergenic
1070800465 10:79242265-79242287 AAGGCAGCAGCTCCCGGGGCGGG + Intronic
1074756010 10:116624680-116624702 AATCCAGCAGCTCACAGCTCTGG + Intronic
1075638376 10:124046220-124046242 AAGCCAGCAGCCCAGGGCACTGG - Exonic
1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG + Intronic
1078396036 11:10982976-10982998 AATCCAGCAGCCCCTGTCTCTGG - Intergenic
1078904379 11:15670847-15670869 AATGGAGCAGCCGCCGGCCCAGG + Intergenic
1081637093 11:44727970-44727992 ACTCCAGCAGGACCCGGAGCCGG - Intronic
1081700146 11:45147365-45147387 CCCGCAGCAGCCCCCGGCGCGGG - Exonic
1086475710 11:87170945-87170967 AAGCCAGCAGCCCCAGGCAGGGG - Intronic
1089623876 11:119739222-119739244 AATCTAGCAGGCCCCTGCCCTGG - Intergenic
1092523726 12:9296984-9297006 AATCCATCAGCGCCAGGCGTTGG - Intergenic
1092543571 12:9434915-9434937 AATCCATCAGCGCCAGGCGTTGG + Intergenic
1094509371 12:31087136-31087158 AATCCATCAGCGCCAGGCGTTGG - Intronic
1101642841 12:106601105-106601127 AACCCAGCAGCCCCTGGGGCAGG + Intronic
1103459306 12:121090987-121091009 ACACCAGCAGCCCCCTGCACTGG - Intergenic
1105049700 12:133037572-133037594 ATTCCCGGAGCCCCCAGCGCCGG - Exonic
1114056922 14:18978263-18978285 AAAGCAGCAGCCCCCTGCTCTGG + Intronic
1114105624 14:19423483-19423505 AAAGCAGCAGCCCCCTGCTCTGG - Intronic
1117656753 14:57963423-57963445 AGCCCAGCAGCCCCTGGGGCTGG + Intronic
1120237008 14:81903699-81903721 GATCCTGCAGCCCCAGGCTCTGG - Intergenic
1122264887 14:100541913-100541935 ACTCCAGCAGCCCCGGGCCCTGG - Intronic
1122486895 14:102087593-102087615 AATCCAGCCGCAAGCGGCGCCGG + Intronic
1125506107 15:40268532-40268554 AAGCCAGCAGCCCTTGGCACTGG + Intronic
1130995163 15:88899400-88899422 AGCCCAGCAGCTCCAGGCGCAGG + Exonic
1132105421 15:99059362-99059384 CACCCTGCAGCCCCAGGCGCGGG + Intergenic
1132611623 16:819620-819642 AGGCCAGCAGCCCCCAGCTCAGG - Intergenic
1136285407 16:29237558-29237580 AAGCCAGCAGCCCCAGAAGCTGG - Intergenic
1137583561 16:49650106-49650128 ATTTCAGCAGCCCCCAGAGCTGG - Intronic
1141771893 16:86094498-86094520 AATCCAGCAGCTCCCAGGCCAGG - Intergenic
1142090732 16:88207690-88207712 AAGCCAGCAGCCCCAGAAGCTGG - Intergenic
1144222858 17:13115420-13115442 AAACCAGCTGCCCCCAGCGGCGG - Intergenic
1144675420 17:17158606-17158628 CATCCAGCAGGCCCTGGCTCAGG + Exonic
1144782392 17:17814619-17814641 ACTCCTGCAGCACCCGGGGCAGG + Exonic
1146096004 17:29930462-29930484 ACTCCAGCGGCCCCCCGCCCTGG - Intronic
1146496421 17:33326641-33326663 AAACCAGCAGCTCCCAGAGCTGG + Intronic
1148206549 17:45783707-45783729 ATTCCAGCCGCGCCGGGCGCTGG - Intergenic
1148617789 17:49013781-49013803 CACCCCGCAGCCCCTGGCGCGGG + Intronic
1152113422 17:78369975-78369997 GATCCAGCAGCCCACAGCGTGGG - Intergenic
1152202268 17:78954068-78954090 AAGCCAGCAGCCCCAGGAGACGG + Intergenic
1152682657 17:81677109-81677131 AACCCAGCTGCCACCAGCGCTGG + Intergenic
1152720421 17:81920940-81920962 AGACCTGCAGCCCACGGCGCGGG + Exonic
1152721849 17:81927390-81927412 AAACCAGCGGCCCCCGCCGCCGG + Intronic
1156250119 18:35344437-35344459 TTCCCAGAAGCCCCCGGCGCGGG + Exonic
1158884775 18:61816392-61816414 ATTACTACAGCCCCCGGCGCAGG - Exonic
1160005474 18:75065733-75065755 AAGCCAGCAGCCACAAGCGCCGG - Intergenic
1160992591 19:1865815-1865837 CCTCCAGCAGCGCCCGGCACAGG + Intergenic
1162325448 19:9996453-9996475 ATTCCAGCAGGCCCAGGCTCAGG - Exonic
1163117690 19:15198117-15198139 ATTCCAGCAACGCCCAGCGCTGG - Intronic
1164989349 19:32673420-32673442 AATCCTGCAGAGCTCGGCGCTGG - Intronic
1165331552 19:35143305-35143327 CATCCAGCAGCCCCCTGCTCCGG + Exonic
1166098173 19:40554608-40554630 TCTCCAGCAGCGCCCGGCACTGG - Exonic
925896976 2:8479910-8479932 GGTCCAGCAGCCCCAGGCGATGG + Intergenic
925911278 2:8575050-8575072 AATCCAGCAGCCTCCTGCATTGG - Intergenic
927883962 2:26707194-26707216 ATTCCAGCAGCCCCAGGGGCTGG - Intronic
928102218 2:28445727-28445749 AATCCAGCAGAGCCAGGCCCAGG - Intergenic
928432709 2:31234130-31234152 CATCCTGCAGCCCCAGGCGGTGG - Intergenic
935852290 2:107235795-107235817 AATGCAGCAGCCCCAGTCACGGG + Intergenic
937045004 2:118846596-118846618 CAGCCAGCCGCCGCCGGCGCGGG - Exonic
938092383 2:128442005-128442027 AATCTAGCAGCTCCCTGCCCAGG - Intergenic
947368987 2:229425615-229425637 AATCCAGGACCCACCGGCTCTGG + Intronic
948857297 2:240736013-240736035 TATCCAGCTGCCCCCTGCCCTGG + Intronic
1172502103 20:35434642-35434664 AAGCCAGCGGCCCCCGGAGGCGG - Exonic
1172985671 20:38986977-38986999 ACCCCAGCAGCCCCAGGCTCAGG - Intronic
1173255919 20:41394328-41394350 CATCCTGCAGCCCCAGGCCCTGG + Intergenic
1175391072 20:58627874-58627896 CACCCAGCAGCCCCTGGAGCCGG + Intergenic
1175972340 20:62693078-62693100 AATCCCGCAGGCCCCGCCCCAGG + Intergenic
1180475409 22:15700875-15700897 AAAGCAGCAGCCCCCTGCTCTGG + Intronic
1180956202 22:19742509-19742531 AACCCACCAGCCCCCGCCTCGGG + Intergenic
1183782827 22:40009584-40009606 AATCCAGCAGGCCCCACCCCGGG - Intronic
1184461160 22:44639005-44639027 AAGCCGGCAGCCCCCGGCCTTGG + Intergenic
1185244075 22:49763970-49763992 ATGCCAGCAGGCCCCGGGGCTGG - Intergenic
1185268788 22:49918865-49918887 TGTCCACCAGCCCCCGGCACCGG - Exonic
956659525 3:71583920-71583942 ACTCCAGCGGCCCCCCGAGCGGG + Intronic
963117032 3:141738705-141738727 AACCCCGCAGCCCCAGGCGGCGG - Intronic
972666744 4:41172212-41172234 CATCCAGCACCCCCCGCCCCAGG + Intronic
975212949 4:71722333-71722355 AATCCAGCAGCCCCAGTCAGCGG - Intergenic
985549487 5:525701-525723 AAGCCAGCAGCCCCCAGGGCTGG - Intergenic
992371247 5:76146335-76146357 CAACCAGCAGCCCTCGGGGCTGG - Intronic
993728767 5:91398014-91398036 TCTCCAGCAGCCCCCAGGGCTGG + Intergenic
999317150 5:150591402-150591424 AATTCTGCAGCCCCTGGGGCAGG - Intergenic
999722478 5:154409167-154409189 AATACAGGCGCCCCCGGTGCAGG - Intronic
1001573560 5:172747010-172747032 ATTACAGCAGCCCCTGGCTCAGG + Intergenic
1002458787 5:179362113-179362135 ACGCCAGCAGCCCCAGGAGCTGG - Intergenic
1002582110 5:180215253-180215275 AAGCCAGCAACCCACGGCTCGGG + Intergenic
1002786053 6:401484-401506 GATCCGGCAGCCCTCGGGGCTGG - Exonic
1006671434 6:35731939-35731961 ACTCCCGCCGCGCCCGGCGCCGG - Intergenic
1006920571 6:37624878-37624900 ATTCTAGCAGCCCCCAGCCCAGG + Intergenic
1016741429 6:147533151-147533173 AATCCACCAAGCCCCGGGGCAGG + Intronic
1018392585 6:163351760-163351782 TATCCAGGAGCCCCAGGTGCTGG + Intergenic
1018544382 6:164919148-164919170 AATCCAGCAGACCCAGGTTCCGG - Intergenic
1018799093 6:167209111-167209133 AACCCAGGAGACCCCGGCCCTGG + Intergenic
1021717821 7:23474767-23474789 AATCCAGAACCTCCGGGCGCTGG - Intergenic
1021998430 7:26201937-26201959 CTTCCCGCAGCTCCCGGCGCGGG - Intronic
1034192676 7:149223957-149223979 CGTCCAGCAGCCCTCGGCTCGGG - Exonic
1034931488 7:155167190-155167212 GAGCCAGCAGCCTCCGGGGCAGG - Intergenic
1035547006 8:489380-489402 AATCCAGCTGCCCAGGACGCAGG + Intergenic
1035584956 8:765530-765552 AATACAGCAGCCCTTGGGGCAGG + Intergenic
1036648823 8:10629222-10629244 AATCCAGCAGCTGCTGGTGCTGG + Intronic
1036723717 8:11201029-11201051 CCTCCCGCGGCCCCCGGCGCCGG - Exonic
1037885746 8:22595342-22595364 ACTCCATGAGCCCCAGGCGCTGG + Intronic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1047219580 8:122908909-122908931 TATCCACCAGCCCCTGGGGCAGG - Intronic
1049343983 8:142128715-142128737 AATCCAGCATCTCCCTGCCCTGG - Intergenic
1050372140 9:4932902-4932924 CATCCAGCAGCCCATGGTGCAGG + Intergenic
1051404975 9:16727257-16727279 CCTCCAGCAACCCTCGGCGCTGG + Intronic
1199745779 X:150771271-150771293 AGCCCAGCAGCCACCGGGGCAGG - Intronic