ID: 1078090372

View in Genome Browser
Species Human (GRCh38)
Location 11:8261325-8261347
Sequence TGAGGTACACTGCAATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078090364_1078090372 22 Left 1078090364 11:8261280-8261302 CCACAGATCTAGCAGAAACCAGA 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1078090372 11:8261325-8261347 TGAGGTACACTGCAATTTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 107
1078090366_1078090372 4 Left 1078090366 11:8261298-8261320 CCAGAAGAAACATCTGCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 196
Right 1078090372 11:8261325-8261347 TGAGGTACACTGCAATTTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078090372 Original CRISPR TGAGGTACACTGCAATTTGG AGG Intronic
900744843 1:4354034-4354056 TGAGGTTCCCTGGAGTTTGGAGG + Intergenic
902302216 1:15510270-15510292 TGGGCTCCACTGCAACTTGGAGG - Intronic
905823236 1:41010450-41010472 GGAGGTGCACTGCAACTTGGAGG - Intronic
906592547 1:47040139-47040161 TATGCTACACTGCAATTTGGAGG - Intronic
913181630 1:116328143-116328165 TGAGGCACACTGAAGTTTGGGGG - Intergenic
916394891 1:164375062-164375084 TGAGGCACAGTGTAATTTGGGGG - Intergenic
921840701 1:219825174-219825196 TGAAGTACAAAGCAATTTGTTGG + Intronic
1065691774 10:28341411-28341433 TGAGGTACACTGTATTTTGGGGG + Intergenic
1067067758 10:43113268-43113290 CGAGGGACACTGCAATGTGCGGG + Intronic
1067128752 10:43542658-43542680 TGAAGTCCACTGCAATTTGTGGG - Intergenic
1068952320 10:62789901-62789923 TGGGGAACACTGAAATTGGGTGG + Intergenic
1069858352 10:71454192-71454214 TGAGGTACACTGCTAGTAAGAGG - Intronic
1072674460 10:97455094-97455116 TGAGGAAAACTGAAAATTGGGGG + Intronic
1074479000 10:113801292-113801314 TCAGGTACACTGGAATTTCAGGG + Intergenic
1078090372 11:8261325-8261347 TGAGGTACACTGCAATTTGGAGG + Intronic
1078442684 11:11380194-11380216 TGAGGGACCCTGGCATTTGGAGG - Intronic
1082788868 11:57333434-57333456 TGGGGGACAGTGAAATTTGGTGG - Exonic
1086111752 11:83206905-83206927 TGAAATAGACTGGAATTTGGAGG + Intronic
1088082270 11:105932907-105932929 TCATGTACACTAAAATTTGGGGG + Intronic
1089158784 11:116422291-116422313 GGAGTTACACTGGACTTTGGAGG + Intergenic
1096775366 12:53960502-53960524 TGGAGTACATTGTAATTTGGGGG - Intergenic
1099557624 12:84129102-84129124 TGAGGTACACAGAAAACTGGAGG - Intergenic
1103264169 12:119615011-119615033 TCAGCCACACTGCATTTTGGGGG + Intronic
1104761007 12:131297527-131297549 TGAGGTTCACTGCCCTTAGGAGG - Intergenic
1104818771 12:131663265-131663287 TGAGGTTCACTGCCCTTAGGAGG + Intergenic
1109478689 13:62919310-62919332 TGAGGTACACGGAAAACTGGAGG + Intergenic
1113815010 13:113163516-113163538 TGATGGACACTGACATTTGGCGG - Intronic
1115966157 14:38890722-38890744 AGAGGTAGGCTGGAATTTGGAGG - Intergenic
1121213252 14:92225580-92225602 TGAAGAACACCGCAATTTGCAGG - Intergenic
1129323897 15:74789538-74789560 TCAGGTGCACTGCCCTTTGGAGG + Intronic
1133554554 16:6892696-6892718 TGAAGTACAGTGCTATTTGTAGG + Intronic
1134904820 16:17971382-17971404 TGAGGCATACTTCAACTTGGGGG - Intergenic
1139496109 16:67319415-67319437 TGAGCTACACTGCAGCTTGTTGG + Intronic
1140103547 16:71938841-71938863 TGAGGTACACTGACAACTGGAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155657137 18:28205383-28205405 GGAGGTTCAGTGAAATTTGGAGG + Intergenic
1156284749 18:35680795-35680817 TGAGGTACACAGCAATTAAGAGG - Intronic
1158744668 18:60186383-60186405 TCAGGTACAGTACAATTTGGTGG + Intergenic
1168523421 19:57070439-57070461 TGAGGTGCACTGCTAATGGGTGG + Intergenic
925552292 2:5089712-5089734 TGAGGTATATTCCAATTTCGGGG + Intergenic
929983662 2:46704498-46704520 TGAGGTAAACTGAATTTTGTAGG + Intronic
933751942 2:85608406-85608428 GGAGGTACACAGTCATTTGGAGG + Exonic
935377963 2:102419985-102420007 TGATGTACTCTGCATTTTGGTGG + Intronic
938201307 2:129375006-129375028 TGGGGTACTCTGTAATTTTGAGG + Intergenic
939249406 2:139665649-139665671 TCAGGTATATTCCAATTTGGAGG + Intergenic
940117819 2:150228698-150228720 TGAGGCAGAATTCAATTTGGAGG - Intergenic
940397306 2:153204612-153204634 TGGGAGACAATGCAATTTGGAGG - Intergenic
940956908 2:159738463-159738485 TGAGGTACACAGACAGTTGGAGG + Intronic
942190483 2:173464392-173464414 TGAGTTTAAATGCAATTTGGGGG - Intergenic
947787887 2:232840921-232840943 TGTGGTTCACTGAAATTAGGAGG + Intronic
947863574 2:233380253-233380275 TGAGGTACATTTCAGTGTGGAGG + Intronic
948977000 2:241469801-241469823 TGAGGTACATAGGACTTTGGAGG + Intronic
1170621035 20:17996270-17996292 AGAAGTACACTGCAATTATGGGG + Intronic
1173334412 20:42101213-42101235 TGAGCCTCCCTGCAATTTGGTGG - Intronic
1175480283 20:59305797-59305819 TGAGGCCCACTACATTTTGGAGG + Intronic
1179456296 21:41503095-41503117 TGAAATACAATGCAATTTGCAGG + Intronic
1181005884 22:20013303-20013325 TGAAGGACACTGCACTTTTGGGG + Intronic
1184492955 22:44820648-44820670 AGGGGCACACTGCACTTTGGTGG + Intronic
1184614905 22:45631379-45631401 TGAGGTAAATTGCAATTAGGGGG + Intergenic
1184621127 22:45678414-45678436 TGAGTGACACTGAATTTTGGTGG + Intronic
949655051 3:6208275-6208297 TGAGATAAACTGTGATTTGGTGG + Intergenic
950015266 3:9750491-9750513 TGGGGTACAAAGGAATTTGGGGG + Intronic
950958010 3:17075656-17075678 AGGGGCACAATGCAATTTGGGGG - Intronic
953824880 3:46242643-46242665 GAAGGTACACAGCAATTTAGAGG + Intronic
954960903 3:54564040-54564062 CAAGGCAGACTGCAATTTGGTGG - Intronic
958691871 3:97479951-97479973 TGAAGTAGTTTGCAATTTGGAGG - Intronic
964388143 3:156171027-156171049 TTACGTACACTGCTTTTTGGCGG + Intronic
965315551 3:167185373-167185395 AGAGGTACAGTAAAATTTGGTGG + Intergenic
970204786 4:13645108-13645130 TGAAATATACGGCAATTTGGGGG - Intergenic
976355541 4:84113078-84113100 TGAGGAAAAGTTCAATTTGGGGG - Intergenic
976664524 4:87576356-87576378 TGTGATACACTGGAATTTGCAGG - Intergenic
978183948 4:105835778-105835800 TGAGGTACACAGACAATTGGAGG + Intronic
979997694 4:127452005-127452027 TGAGGAACACTGACATTTGTAGG - Intergenic
981886522 4:149680520-149680542 TGAAGTATACTTCAATTGGGTGG + Intergenic
983962132 4:173767844-173767866 TGAGGCACCCTGCAATGGGGGGG - Intergenic
984325261 4:178242511-178242533 TGAGGTACACAGAAAAGTGGAGG - Intergenic
987906536 5:24084956-24084978 TAAGGTACAGTAAAATTTGGTGG + Intronic
988405011 5:30812760-30812782 TAAGGTACACTGGAGTTTGCTGG - Intergenic
988867056 5:35346977-35346999 TGAGGTACACTCTAAGTTGTGGG - Intergenic
988920105 5:35933369-35933391 TGAGGTACAGAGAGATTTGGAGG + Intronic
992954513 5:81893499-81893521 TTAGCTACACTGAATTTTGGGGG - Intergenic
994852281 5:105071150-105071172 TGAGGTACTCTGCACTTTAACGG - Intergenic
996327422 5:122291343-122291365 TGAGTCATACTGCAATTTGCAGG - Intergenic
997101338 5:130972406-130972428 TAATGTACACTGCAACTTGAAGG + Intergenic
998998953 5:147898644-147898666 TGAGGAACAATGACATTTGGAGG + Intronic
1002830700 6:817794-817816 TGATATACACAGCACTTTGGAGG - Intergenic
1003307539 6:4943260-4943282 TGAGCTGCACTGGAATTTGCAGG - Intronic
1003510437 6:6775145-6775167 TGAGGTACAGTGAAATTAAGTGG + Intergenic
1003875347 6:10431260-10431282 TGAGCTACAGTTCAGTTTGGTGG + Intergenic
1005345116 6:24881717-24881739 ACAGGTACACTGGACTTTGGTGG + Intronic
1006210871 6:32393613-32393635 TGAGGTTCACTGAGATTTGTTGG - Intergenic
1013839284 6:114371228-114371250 TGAGGGACACTTCAAGTTGCAGG + Intergenic
1015147862 6:130007271-130007293 TGTGGCCCACTGGAATTTGGAGG - Intergenic
1015173004 6:130275466-130275488 TGAATTACACTGAACTTTGGAGG + Intronic
1015696383 6:135984798-135984820 TGAGGTACACTGAGATCAGGTGG + Intronic
1018377136 6:163223693-163223715 TGAGGTAGACTGCTTTTTGCTGG + Intronic
1021087174 7:16434844-16434866 TGAGTTACCATGCAATTTTGGGG - Intergenic
1022432761 7:30342814-30342836 TGAGGTACTTTGTATTTTGGGGG + Intronic
1023306696 7:38837626-38837648 TGACATACACTGCAAGTTGTGGG - Intronic
1023699468 7:42878209-42878231 TGAGGTACACAGAAAAGTGGAGG - Intergenic
1024300224 7:47881865-47881887 TCAGAAACACTGCAAATTGGAGG + Intronic
1027995839 7:85424277-85424299 TGAGGTACACAGAAAACTGGAGG - Intergenic
1028117530 7:87017201-87017223 TTAGATACACTCCATTTTGGGGG + Intronic
1029240992 7:99162359-99162381 TGAGGTACATTACAATTTCTGGG + Intergenic
1032858561 7:135857672-135857694 TGAGGTACACAGAAAAGTGGAGG + Intergenic
1035157040 7:156922774-156922796 TTAAGCACACTGCCATTTGGAGG - Intergenic
1036722141 8:11186251-11186273 AGAGGTAGACTGCATTTTGGTGG - Intronic
1043212243 8:77536576-77536598 TGAATTACACTAAAATTTGGGGG - Intergenic
1046103712 8:109643643-109643665 TGAAGTACCCTGCCATTTCGTGG + Intronic
1054721447 9:68608130-68608152 TGGTGAACCCTGCAATTTGGAGG + Intergenic
1056462205 9:86818825-86818847 TGAGGTACACGGCCAACTGGAGG - Intergenic
1057251872 9:93509441-93509463 TCTGGTACTCTGCAATGTGGAGG + Intronic
1058270592 9:102967591-102967613 TGAGGTACATGGAAAATTGGAGG + Intergenic
1186509470 X:10119700-10119722 TGAGTGACACTGCCATCTGGTGG + Intronic
1189703397 X:43735171-43735193 TGAGGAACACTTTAATTTGTGGG + Intronic
1194183679 X:90744823-90744845 GGAGGTACATTGAAATTTGATGG - Intergenic
1199314020 X:146356227-146356249 TGAGGAACTCAGCAATTTGATGG + Intergenic
1199359967 X:146906716-146906738 TGAGGTACACAGAAAAGTGGAGG + Intergenic
1200530281 Y:4326772-4326794 GGAGGTACATTGAAATTTGATGG - Intergenic