ID: 1078090986

View in Genome Browser
Species Human (GRCh38)
Location 11:8264531-8264553
Sequence CAGGATTCTGGGGAGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 441}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078090986_1078090996 6 Left 1078090986 11:8264531-8264553 CCCTGCTTCTCCCCAGAATCCTG 0: 1
1: 0
2: 2
3: 39
4: 441
Right 1078090996 11:8264560-8264582 ATGTTCTGGCTGCCTACCCTAGG 0: 1
1: 0
2: 0
3: 6
4: 141
1078090986_1078090997 10 Left 1078090986 11:8264531-8264553 CCCTGCTTCTCCCCAGAATCCTG 0: 1
1: 0
2: 2
3: 39
4: 441
Right 1078090997 11:8264564-8264586 TCTGGCTGCCTACCCTAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 126
1078090986_1078090994 -8 Left 1078090986 11:8264531-8264553 CCCTGCTTCTCCCCAGAATCCTG 0: 1
1: 0
2: 2
3: 39
4: 441
Right 1078090994 11:8264546-8264568 GAATCCTGGGGCTGATGTTCTGG 0: 1
1: 0
2: 0
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078090986 Original CRISPR CAGGATTCTGGGGAGAAGCA GGG (reversed) Intronic