ID: 1078099150

View in Genome Browser
Species Human (GRCh38)
Location 11:8319466-8319488
Sequence TTCACGAAGGGAAAGTCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078099150_1078099164 30 Left 1078099150 11:8319466-8319488 CCCCTCGACTTTCCCTTCGTGAA No data
Right 1078099164 11:8319519-8319541 CAGAAACGCTGGGATGGTCCTGG No data
1078099150_1078099161 20 Left 1078099150 11:8319466-8319488 CCCCTCGACTTTCCCTTCGTGAA No data
Right 1078099161 11:8319509-8319531 TTGCCTGAGGCAGAAACGCTGGG No data
1078099150_1078099157 7 Left 1078099150 11:8319466-8319488 CCCCTCGACTTTCCCTTCGTGAA No data
Right 1078099157 11:8319496-8319518 GCCATCACCTCAATTGCCTGAGG No data
1078099150_1078099163 24 Left 1078099150 11:8319466-8319488 CCCCTCGACTTTCCCTTCGTGAA No data
Right 1078099163 11:8319513-8319535 CTGAGGCAGAAACGCTGGGATGG No data
1078099150_1078099160 19 Left 1078099150 11:8319466-8319488 CCCCTCGACTTTCCCTTCGTGAA No data
Right 1078099160 11:8319508-8319530 ATTGCCTGAGGCAGAAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078099150 Original CRISPR TTCACGAAGGGAAAGTCGAG GGG (reversed) Intergenic
No off target data available for this crispr