ID: 1078101097

View in Genome Browser
Species Human (GRCh38)
Location 11:8330743-8330765
Sequence TTACAGGGTCCATGATGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078101097_1078101103 24 Left 1078101097 11:8330743-8330765 CCATGGCATCATGGACCCTGTAA No data
Right 1078101103 11:8330790-8330812 CTGGCTGTGCTCCTTATTAGCGG No data
1078101097_1078101104 25 Left 1078101097 11:8330743-8330765 CCATGGCATCATGGACCCTGTAA No data
Right 1078101104 11:8330791-8330813 TGGCTGTGCTCCTTATTAGCGGG No data
1078101097_1078101105 26 Left 1078101097 11:8330743-8330765 CCATGGCATCATGGACCCTGTAA No data
Right 1078101105 11:8330792-8330814 GGCTGTGCTCCTTATTAGCGGGG No data
1078101097_1078101101 5 Left 1078101097 11:8330743-8330765 CCATGGCATCATGGACCCTGTAA No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078101097 Original CRISPR TTACAGGGTCCATGATGCCA TGG (reversed) Intergenic
No off target data available for this crispr