ID: 1078101101

View in Genome Browser
Species Human (GRCh38)
Location 11:8330771-8330793
Sequence GATAGAGCCGACTTGAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078101095_1078101101 16 Left 1078101095 11:8330732-8330754 CCTCTCTGGCACCATGGCATCAT No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101098_1078101101 -10 Left 1078101098 11:8330758-8330780 CCCTGTAAAACCAGATAGAGCCG No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101089_1078101101 25 Left 1078101089 11:8330723-8330745 CCACCCGCCCCTCTCTGGCACCA No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101090_1078101101 22 Left 1078101090 11:8330726-8330748 CCCGCCCCTCTCTGGCACCATGG No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101094_1078101101 17 Left 1078101094 11:8330731-8330753 CCCTCTCTGGCACCATGGCATCA No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101088_1078101101 26 Left 1078101088 11:8330722-8330744 CCCACCCGCCCCTCTCTGGCACC No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101085_1078101101 30 Left 1078101085 11:8330718-8330740 CCTCCCCACCCGCCCCTCTCTGG No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101092_1078101101 21 Left 1078101092 11:8330727-8330749 CCGCCCCTCTCTGGCACCATGGC No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101093_1078101101 18 Left 1078101093 11:8330730-8330752 CCCCTCTCTGGCACCATGGCATC No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101087_1078101101 27 Left 1078101087 11:8330721-8330743 CCCCACCCGCCCCTCTCTGGCAC No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data
1078101097_1078101101 5 Left 1078101097 11:8330743-8330765 CCATGGCATCATGGACCCTGTAA No data
Right 1078101101 11:8330771-8330793 GATAGAGCCGACTTGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078101101 Original CRISPR GATAGAGCCGACTTGAAATC TGG Intergenic
No off target data available for this crispr