ID: 1078101102

View in Genome Browser
Species Human (GRCh38)
Location 11:8330778-8330800
Sequence AGCACAGCCAGATTTCAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078101102_1078101104 -10 Left 1078101102 11:8330778-8330800 CCGACTTGAAATCTGGCTGTGCT No data
Right 1078101104 11:8330791-8330813 TGGCTGTGCTCCTTATTAGCGGG No data
1078101102_1078101108 1 Left 1078101102 11:8330778-8330800 CCGACTTGAAATCTGGCTGTGCT No data
Right 1078101108 11:8330802-8330824 CTTATTAGCGGGGTGACCTTGGG No data
1078101102_1078101107 0 Left 1078101102 11:8330778-8330800 CCGACTTGAAATCTGGCTGTGCT No data
Right 1078101107 11:8330801-8330823 CCTTATTAGCGGGGTGACCTTGG No data
1078101102_1078101105 -9 Left 1078101102 11:8330778-8330800 CCGACTTGAAATCTGGCTGTGCT No data
Right 1078101105 11:8330792-8330814 GGCTGTGCTCCTTATTAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078101102 Original CRISPR AGCACAGCCAGATTTCAAGT CGG (reversed) Intergenic
No off target data available for this crispr