ID: 1078101104

View in Genome Browser
Species Human (GRCh38)
Location 11:8330791-8330813
Sequence TGGCTGTGCTCCTTATTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078101100_1078101104 0 Left 1078101100 11:8330768-8330790 CCAGATAGAGCCGACTTGAAATC No data
Right 1078101104 11:8330791-8330813 TGGCTGTGCTCCTTATTAGCGGG No data
1078101098_1078101104 10 Left 1078101098 11:8330758-8330780 CCCTGTAAAACCAGATAGAGCCG No data
Right 1078101104 11:8330791-8330813 TGGCTGTGCTCCTTATTAGCGGG No data
1078101102_1078101104 -10 Left 1078101102 11:8330778-8330800 CCGACTTGAAATCTGGCTGTGCT No data
Right 1078101104 11:8330791-8330813 TGGCTGTGCTCCTTATTAGCGGG No data
1078101097_1078101104 25 Left 1078101097 11:8330743-8330765 CCATGGCATCATGGACCCTGTAA No data
Right 1078101104 11:8330791-8330813 TGGCTGTGCTCCTTATTAGCGGG No data
1078101099_1078101104 9 Left 1078101099 11:8330759-8330781 CCTGTAAAACCAGATAGAGCCGA No data
Right 1078101104 11:8330791-8330813 TGGCTGTGCTCCTTATTAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078101104 Original CRISPR TGGCTGTGCTCCTTATTAGC GGG Intergenic
No off target data available for this crispr