ID: 1078101107

View in Genome Browser
Species Human (GRCh38)
Location 11:8330801-8330823
Sequence CCTTATTAGCGGGGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078101100_1078101107 10 Left 1078101100 11:8330768-8330790 CCAGATAGAGCCGACTTGAAATC No data
Right 1078101107 11:8330801-8330823 CCTTATTAGCGGGGTGACCTTGG No data
1078101102_1078101107 0 Left 1078101102 11:8330778-8330800 CCGACTTGAAATCTGGCTGTGCT No data
Right 1078101107 11:8330801-8330823 CCTTATTAGCGGGGTGACCTTGG No data
1078101099_1078101107 19 Left 1078101099 11:8330759-8330781 CCTGTAAAACCAGATAGAGCCGA No data
Right 1078101107 11:8330801-8330823 CCTTATTAGCGGGGTGACCTTGG No data
1078101098_1078101107 20 Left 1078101098 11:8330758-8330780 CCCTGTAAAACCAGATAGAGCCG No data
Right 1078101107 11:8330801-8330823 CCTTATTAGCGGGGTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078101107 Original CRISPR CCTTATTAGCGGGGTGACCT TGG Intergenic
No off target data available for this crispr