ID: 1078107214

View in Genome Browser
Species Human (GRCh38)
Location 11:8365860-8365882
Sequence GGTGCTGAAGCCCGAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078107214_1078107218 4 Left 1078107214 11:8365860-8365882 CCTGGAACTCGGGCTTCAGCACC No data
Right 1078107218 11:8365887-8365909 TCCATTTGTCCTTCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078107214 Original CRISPR GGTGCTGAAGCCCGAGTTCC AGG (reversed) Intergenic
No off target data available for this crispr