ID: 1078108013

View in Genome Browser
Species Human (GRCh38)
Location 11:8370776-8370798
Sequence CCTGACAAGAGAGCCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078108013_1078108023 22 Left 1078108013 11:8370776-8370798 CCAACCTAGGCTCTCTTGTCAGG No data
Right 1078108023 11:8370821-8370843 GTGGCTGGGAATTTGGTTCCTGG No data
1078108013_1078108024 23 Left 1078108013 11:8370776-8370798 CCAACCTAGGCTCTCTTGTCAGG No data
Right 1078108024 11:8370822-8370844 TGGCTGGGAATTTGGTTCCTGGG No data
1078108013_1078108017 3 Left 1078108013 11:8370776-8370798 CCAACCTAGGCTCTCTTGTCAGG No data
Right 1078108017 11:8370802-8370824 ACTGCGCCCAGCACGAGAAGTGG No data
1078108013_1078108019 8 Left 1078108013 11:8370776-8370798 CCAACCTAGGCTCTCTTGTCAGG No data
Right 1078108019 11:8370807-8370829 GCCCAGCACGAGAAGTGGCTGGG No data
1078108013_1078108018 7 Left 1078108013 11:8370776-8370798 CCAACCTAGGCTCTCTTGTCAGG No data
Right 1078108018 11:8370806-8370828 CGCCCAGCACGAGAAGTGGCTGG No data
1078108013_1078108022 15 Left 1078108013 11:8370776-8370798 CCAACCTAGGCTCTCTTGTCAGG No data
Right 1078108022 11:8370814-8370836 ACGAGAAGTGGCTGGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078108013 Original CRISPR CCTGACAAGAGAGCCTAGGT TGG (reversed) Intergenic
No off target data available for this crispr