ID: 1078108206

View in Genome Browser
Species Human (GRCh38)
Location 11:8371862-8371884
Sequence AAAAATAAAGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078108206_1078108214 28 Left 1078108206 11:8371862-8371884 CCTCCCTCCTTCTCTTTATTTTT No data
Right 1078108214 11:8371913-8371935 TCTCACTCTCTTGCCCAGGCTGG 0: 454
1: 24894
2: 80134
3: 176700
4: 234018
1078108206_1078108213 24 Left 1078108206 11:8371862-8371884 CCTCCCTCCTTCTCTTTATTTTT No data
Right 1078108213 11:8371909-8371931 TGGGTCTCACTCTCTTGCCCAGG 0: 4
1: 286
2: 7415
3: 44263
4: 115537
1078108206_1078108212 5 Left 1078108206 11:8371862-8371884 CCTCCCTCCTTCTCTTTATTTTT No data
Right 1078108212 11:8371890-8371912 ATTTTTATTTTTTTGAGACTGGG 0: 11
1: 286
2: 1964
3: 21688
4: 33887
1078108206_1078108211 4 Left 1078108206 11:8371862-8371884 CCTCCCTCCTTCTCTTTATTTTT No data
Right 1078108211 11:8371889-8371911 TATTTTTATTTTTTTGAGACTGG 0: 223
1: 795
2: 17983
3: 26820
4: 42805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078108206 Original CRISPR AAAAATAAAGAGAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr