ID: 1078108344

View in Genome Browser
Species Human (GRCh38)
Location 11:8372672-8372694
Sequence TTCCCAAGGCTGACTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078108337_1078108344 29 Left 1078108337 11:8372620-8372642 CCGCATAGGCGGGTTGAAGGGCG No data
Right 1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG No data
1078108339_1078108344 0 Left 1078108339 11:8372649-8372671 CCTGAGTTCACAGCCACATCTTC No data
Right 1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078108344 Original CRISPR TTCCCAAGGCTGACTGGGAC AGG Intergenic
No off target data available for this crispr