ID: 1078110828

View in Genome Browser
Species Human (GRCh38)
Location 11:8390435-8390457
Sequence CTGTGAAAGCAAATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078110825_1078110828 -10 Left 1078110825 11:8390422-8390444 CCTTTTTTCACAGCTGTGAAAGC No data
Right 1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG No data
1078110824_1078110828 -9 Left 1078110824 11:8390421-8390443 CCCTTTTTTCACAGCTGTGAAAG No data
Right 1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG No data
1078110822_1078110828 30 Left 1078110822 11:8390382-8390404 CCTATCAGTCATTGAAAGTCAAT No data
Right 1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078110828 Original CRISPR CTGTGAAAGCAAATGGAGGA AGG Intergenic
No off target data available for this crispr