ID: 1078114488

View in Genome Browser
Species Human (GRCh38)
Location 11:8432070-8432092
Sequence CCTAGCACCTAGTACCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078114485_1078114488 10 Left 1078114485 11:8432037-8432059 CCACGTCTTACGTGGCTTTAACT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1078114488 11:8432070-8432092 CCTAGCACCTAGTACCTGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 154
1078114483_1078114488 24 Left 1078114483 11:8432023-8432045 CCTTATGTCAGAGACCACGTCTT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1078114488 11:8432070-8432092 CCTAGCACCTAGTACCTGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078114488 Original CRISPR CCTAGCACCTAGTACCTGGT AGG Intronic
901195192 1:7436430-7436452 CCTAGCACTAAGCACCTGGAGGG + Intronic
902680109 1:18037332-18037354 CCTAGGACCTAGTACCTAGTAGG + Intergenic
903262321 1:22138000-22138022 CTGAGCACCTAGTACCTGACAGG + Intronic
903307820 1:22425889-22425911 CCCAGCACCTAGTACAATGTTGG + Intergenic
903891020 1:26570661-26570683 ACTAGCTCCTAGTACATGGCAGG - Intronic
903994828 1:27299216-27299238 CCTAGTACCTAGCACATAGTAGG - Intronic
904117864 1:28175642-28175664 CCCAGCACCTGGGACCTGATAGG + Intronic
904581818 1:31549275-31549297 CCCAGCACCTAGCACATAGTAGG - Intergenic
905105661 1:35562217-35562239 CCCAGCACCTAGCATGTGGTAGG - Intronic
905478926 1:38248030-38248052 TCTGGCACCTGGCACCTGGTTGG + Intergenic
906677401 1:47702994-47703016 CCTAACACCTATTTCCAGGTGGG + Intergenic
907807327 1:57834463-57834485 CCTAGTGCCTGGTACATGGTAGG - Intronic
908578884 1:65492418-65492440 ACTAATACCTAGTACCTAGTAGG - Intronic
914027682 1:143926864-143926886 CATAGTACCTGATACCTGGTAGG + Intergenic
919781133 1:201221879-201221901 CCCAGTACCTAGCACCTAGTAGG - Intronic
920050172 1:203159743-203159765 CCTAGAACCTGGCACCTGATAGG + Intronic
920651275 1:207839153-207839175 CCCAGTGCCTAGTACATGGTAGG - Intergenic
1070528844 10:77318589-77318611 CATAGAACCAAGCACCTGGTAGG + Intronic
1073470160 10:103717277-103717299 CCTGGCACCTAGTAAGTGTTGGG - Intronic
1074384325 10:113005104-113005126 CCTGGCACCTAGCACGTGTTGGG + Intronic
1076560936 10:131363105-131363127 CCTGGCACCTAGAACCTAATAGG - Intergenic
1078114488 11:8432070-8432092 CCTAGCACCTAGTACCTGGTAGG + Intronic
1078128895 11:8595177-8595199 CCTAGAGCCTGGTACCTAGTAGG - Intergenic
1078494072 11:11798540-11798562 CTTAACACCTAGTATATGGTAGG + Intergenic
1080083220 11:28246561-28246583 CATAGCACTTATTACCTGCTAGG - Intronic
1080216266 11:29844811-29844833 AATAGCACCTAGTAAATGGTTGG - Intergenic
1082122720 11:48396705-48396727 CCTAGCACATAGTGCTTTGTAGG + Intergenic
1082251909 11:49991970-49991992 CCTAGCACATAGTGCTTAGTAGG - Intergenic
1085821241 11:79795915-79795937 CCTAGCAGATAGTACGTGGTAGG - Intergenic
1087105457 11:94402751-94402773 CCTAGCACCTTGTCCCTTCTAGG - Intergenic
1087778322 11:102277165-102277187 CGTCGCACCTAGCACATGGTGGG - Intergenic
1088709034 11:112490073-112490095 CAGAGCACCTAGTACATAGTAGG - Intergenic
1088954154 11:114603298-114603320 GGTAACACCTATTACCTGGTGGG + Intergenic
1089581431 11:119483992-119484014 CCCAGGACCTAGCACCTTGTGGG - Intergenic
1094818547 12:34208201-34208223 CCCACCACCTGGTACCTGGGAGG + Intergenic
1095045601 12:37500664-37500686 CCTGGCACCAGGTGCCTGGTCGG - Intergenic
1095819137 12:46458205-46458227 AATAGCACCTGGTACATGGTAGG - Intergenic
1097226945 12:57482763-57482785 CCTAGCACATAGTTCCTGCCCGG - Intronic
1098076504 12:66737770-66737792 CATAACACCTGGCACCTGGTGGG - Intronic
1098590580 12:72206492-72206514 CATAGTGCCTAGTACCTAGTAGG + Intronic
1099139346 12:78951964-78951986 CATAGCATCTGGTAACTGGTTGG + Intronic
1101609343 12:106276321-106276343 CCTGGCACATAGTACATGCTCGG - Intronic
1102467813 12:113140572-113140594 CCTACCATCTAGTACATTGTAGG - Intergenic
1103206754 12:119135630-119135652 CCTAGCACCTGGTGCATAGTAGG - Intronic
1103253921 12:119523877-119523899 CCCAGCACCTGGCACCTGGCAGG - Intronic
1103256000 12:119541966-119541988 CTTAACACCTAGAACTTGGTTGG - Intergenic
1103754742 12:123195664-123195686 CCTAGTGCCTAGCACCTAGTGGG - Intronic
1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG + Intronic
1107276322 13:38684073-38684095 CCTAATACCTAGTACCTAGTAGG - Intergenic
1108125501 13:47238580-47238602 CCTAGCACCTCGTATCTCCTGGG + Intergenic
1110069492 13:71156195-71156217 CCTATTGCCTAGTACGTGGTTGG + Intergenic
1111105370 13:83638636-83638658 CCTGGCACCTAGTAGCTATTGGG + Intergenic
1112206643 13:97330318-97330340 CCTAGCTCCCAGTTCCTGGGAGG + Intronic
1112493175 13:99885061-99885083 CCCAGCACCCAGTACCTGCCAGG - Intronic
1112749313 13:102566064-102566086 CCTAGCTCCTAGTAAATGGGAGG - Intergenic
1117001482 14:51375519-51375541 CATATCTCCTGGTACCTGGTGGG + Intergenic
1117032871 14:51693005-51693027 CCCAGTACCTGGTACCTAGTGGG + Intronic
1117211322 14:53503442-53503464 CCTAGTACCTAGCACATGGTAGG - Intergenic
1119557108 14:75561711-75561733 CGTAGTACCTAATACCTGATAGG + Intergenic
1119978515 14:79053217-79053239 CCCAGCACTTAGTACATGGCAGG + Intronic
1128364933 15:66992747-66992769 CCTAGGACCTTGTGCCTAGTAGG - Intergenic
1129442335 15:75590666-75590688 CCTAGAACCTAGAACATAGTAGG + Intergenic
1132643005 16:986346-986368 CCCAGCACCCAGTACCAGTTTGG + Exonic
1133070403 16:3243046-3243068 CATAGCAGCTAGCACCTAGTCGG + Exonic
1134837560 16:17374892-17374914 CATAGCACCTAGCACATTGTAGG - Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1136003192 16:27311811-27311833 CCTAGCCCTGAGGACCTGGTTGG - Intergenic
1137765748 16:50976384-50976406 CCTAGCATCTACTACATGTTGGG - Intergenic
1138130979 16:54479694-54479716 CACAGTGCCTAGTACCTGGTAGG + Intergenic
1138835392 16:60428714-60428736 CCTAGCACCTAGAACATTATGGG - Intergenic
1139386426 16:66575261-66575283 CCTGGCATCTAGTAGCTGGTGGG - Intronic
1143353112 17:6303884-6303906 CCCAGCACCTAGTCCCTGCTTGG + Intergenic
1144407116 17:14962764-14962786 CCTGGCACCTAGGAGCTGGCTGG + Intergenic
1145095641 17:20023372-20023394 CTCAGCACCTAGTACCTAGTAGG - Intronic
1146660498 17:34662461-34662483 CCTGGCACCTAGTAGGTGCTCGG - Intergenic
1153263896 18:3248985-3249007 GATAGCACCTAGTATTTGGTGGG - Intronic
1155436973 18:25823744-25823766 ATTAGCACCTACTACCTGCTAGG + Intergenic
1157962467 18:52171003-52171025 CTTAGCACCTAGTATGTGCTTGG - Intergenic
1158337804 18:56432842-56432864 CCTAGTACCTAGTATCAGGAAGG + Intergenic
1161043589 19:2122858-2122880 CCTGGTACCTTGTACCTGGGCGG - Intronic
1161753312 19:6113444-6113466 CCTAGCACCTAGCAAATAGTAGG - Intronic
1162394239 19:10407154-10407176 CCTGGCACCTGGTACATAGTAGG - Intronic
1162395252 19:10414469-10414491 CCTAGCCTTTAGCACCTGGTGGG - Intronic
1163172105 19:15538807-15538829 CCCAGCACCTAGTTCAGGGTTGG - Intronic
1164783673 19:30912867-30912889 CCTAGAACCTAGAACCTTGACGG + Intergenic
1166236024 19:41457431-41457453 CCAAGAACCTAGTAACTGTTGGG - Intergenic
925982138 2:9185480-9185502 TCAAGCACCTAGCACATGGTAGG + Intergenic
926768550 2:16347271-16347293 CCAAGCACCTAGCACATGGTGGG + Intergenic
931261551 2:60624187-60624209 CACAGTACCTAGCACCTGGTAGG - Intergenic
931365156 2:61612844-61612866 CCTAACACTTGCTACCTGGTAGG - Intergenic
939558336 2:143703874-143703896 CCCAGCACGTGGTACATGGTGGG - Intronic
939572616 2:143858131-143858153 CACAGAACCTAGTACATGGTAGG + Intergenic
943797132 2:192010610-192010632 CCTAGTACCTGGTACCAAGTAGG - Intronic
944510906 2:200465061-200465083 CATGGCACCTAGTGCCTGCTTGG - Intronic
947612939 2:231534965-231534987 CTTAACACCTACTCCCTGGTAGG - Intergenic
1171540162 20:25944266-25944288 CCTGGCACCAGGTGCCTGGTCGG - Intergenic
1171843196 20:30240637-30240659 CCTAGCACCAGGTGCCTGGTCGG - Intergenic
1172507571 20:35474921-35474943 CCCAGTTCCTTGTACCTGGTAGG + Intronic
1172895307 20:38295930-38295952 CCTGGCACCTAGAACCAGCTAGG + Intronic
1174135644 20:48376979-48377001 CTTAGCTCCAAGGACCTGGTTGG - Intergenic
1174576942 20:51543256-51543278 CCCAGCACCTGGCACGTGGTAGG - Intronic
1179047136 21:37856044-37856066 CCTAGCACCCAGTCCCAGGGAGG - Intronic
1179050308 21:37883514-37883536 CCAAGCACCTAGTGCCAGGTGGG + Intronic
1181960144 22:26616849-26616871 CCTACCACTTAGTAGCTGTTTGG - Intronic
1182593904 22:31403306-31403328 CCAGGCACTTACTACCTGGTAGG + Intronic
1183016032 22:34988008-34988030 TCCAGCACCTAGAACCTAGTAGG + Intergenic
1183379634 22:37484480-37484502 CCTAGAACCTTGCTCCTGGTTGG - Intronic
1183717174 22:39540299-39540321 GCTGGCACCTAGTACACGGTAGG - Intergenic
950782696 3:15405838-15405860 CTTAGTACCTAGTACCTGGCAGG - Intronic
954463486 3:50640897-50640919 CCAAGCACCCAGTTCCTGGTGGG - Intronic
955487949 3:59453691-59453713 CCTAGCACCTAATATATAGTAGG - Intergenic
956792750 3:72692848-72692870 CCTAGTGCCTGGTACTTGGTGGG + Intergenic
967905530 3:194496412-194496434 TATAGCACTTACTACCTGGTAGG + Intronic
969399721 4:6946185-6946207 CATAGCACCTAGAACATAGTTGG + Intronic
972220107 4:36945545-36945567 CCCAGCACCAAGAACCTAGTAGG - Intergenic
972793163 4:42392372-42392394 CCTAGGACCTAGCACATAGTGGG - Intergenic
973547742 4:51998924-51998946 CCTAGCACCTAGTACATAGCAGG + Intronic
975716473 4:77210100-77210122 CTTAGCGCCAAGTTCCTGGTTGG - Intronic
979535453 4:121814931-121814953 CCTAGCTCCCAGTTCCTTGTAGG - Intronic
979799437 4:124889813-124889835 CAAAGTACCTAGTACCTAGTAGG + Intergenic
981208920 4:142077919-142077941 CCTAGAAACTAGTATGTGGTGGG + Intronic
981469119 4:145109869-145109891 CCTAGCACCTAGGACATAGAAGG - Intronic
990122721 5:52475377-52475399 CCTTACAGCTAGTGCCTGGTAGG + Intergenic
991342849 5:65631097-65631119 CCTAGCACCTAGTGCAAAGTAGG - Intronic
993464498 5:88228721-88228743 CCTGGCATCTAGTAAGTGGTTGG - Intronic
994687992 5:102981315-102981337 CTTAGCTCCCAGTACCTAGTTGG + Intronic
996803521 5:127429529-127429551 CATAGCACCTAGCACATGGGAGG - Intronic
997695357 5:135857007-135857029 CCTGGCACCTTGTCCCTGGAAGG + Intronic
997894997 5:137708545-137708567 CTGAGCACCTGGTACATGGTAGG - Intronic
998563084 5:143189890-143189912 CTTAGCACCTAGTACATGCTAGG - Intronic
998586120 5:143429574-143429596 TCATGCACCTAGAACCTGGTGGG + Intronic
1000334769 5:160233940-160233962 CCTTGCAGCTAGAACATGGTGGG + Intronic
1001640511 5:173240580-173240602 CCCAGCACCTGGTACATAGTGGG - Intergenic
1001853026 5:174985764-174985786 CCCAGCACCAAGTACCAGGCCGG - Intergenic
1004130699 6:12916569-12916591 CCCAGCACCTAGTACAGAGTAGG + Intronic
1006575512 6:35042477-35042499 CCCAGTGCTTAGTACCTGGTAGG + Intronic
1008039045 6:46776573-46776595 CCTAGCACGTGGTAGCTGCTTGG - Intergenic
1008425624 6:51352674-51352696 CATAGTTCCTGGTACCTGGTAGG - Intergenic
1011633109 6:89346297-89346319 TGTAGCATCTAGTACCTAGTAGG - Intronic
1016466803 6:144333923-144333945 CCTAGCACATAGTAGGTGGGTGG - Intronic
1019549871 7:1596753-1596775 CCTGGCACAGGGTACCTGGTTGG - Intergenic
1021544234 7:21795262-21795284 CCTAGTACCTAGTACCTAGTGGG + Intronic
1021962925 7:25890375-25890397 CCCAGCACCCAGTACTAGGTTGG + Intergenic
1025291595 7:57730507-57730529 CCTGGCACCAGGTGCCTGGTCGG - Intergenic
1026082013 7:67230245-67230267 CATAGCACCTAGTACCCAGTAGG + Intronic
1026286153 7:68964717-68964739 CCTAGAACCTAGTAGATGCTTGG + Intergenic
1026695054 7:72583748-72583770 CATAGCACCTAGTACCCAGTAGG - Intronic
1030010381 7:105160463-105160485 CCTAGGCCCTAGTACCTAATTGG - Intronic
1030670727 7:112333306-112333328 TCTAGCATCTGGTACCTGGAAGG - Intronic
1032011061 7:128348319-128348341 CCCAGCACCTAGTACGTCATAGG + Intergenic
1032257710 7:130310644-130310666 CAGAGCACCTAGTCCATGGTGGG - Intronic
1033973520 7:147071900-147071922 TCCAGCCCCTAGTACATGGTTGG - Intronic
1037102635 8:15065825-15065847 GCTAGCACTTAGCACGTGGTAGG + Intronic
1040080448 8:43279005-43279027 CCTGGCACCTAGTGCCACGTAGG + Intergenic
1041948861 8:63477442-63477464 TTTAGCACCTAGTACGTAGTAGG + Intergenic
1046692652 8:117303429-117303451 CCTAGCACCTATTTCACGGTAGG + Intergenic
1050317862 9:4421769-4421791 ACTAGCACCTAGGACATAGTTGG - Intergenic
1050455038 9:5826455-5826477 CCCAGTGCCTAGCACCTGGTAGG + Intronic
1052826151 9:33176734-33176756 CCCAGCAGGTAGTACCTGATGGG - Intergenic
1053211521 9:36232849-36232871 CCCAGTGCCTAGTACATGGTAGG + Intronic
1054164901 9:61715193-61715215 CCTGGCACCAGGTGCCTGGTCGG + Intergenic
1056104737 9:83335991-83336013 GCTAGCATCTAGTACCTGAAGGG - Intronic
1058465811 9:105226025-105226047 TCTAGCACCCAGCACATGGTGGG + Intergenic
1060242271 9:121914388-121914410 CTGAGCACCTATTACCTGGGAGG + Intronic
1061036054 9:128114940-128114962 CCTTGCCCCAAGTTCCTGGTGGG - Intergenic
1061154189 9:128847171-128847193 CCCAGAACCCAGTACCTGGTAGG - Intronic
1062586472 9:137252048-137252070 CTCGGCACCTGGTACCTGGTGGG - Exonic
1187604754 X:20871070-20871092 CACAGCTCCTGGTACCTGGTAGG + Intergenic
1190969443 X:55334573-55334595 CATAGCACCTGCTACCTGGATGG - Intergenic
1192264258 X:69528208-69528230 GCTAGGACCCAGTGCCTGGTAGG + Intronic
1195705811 X:107737286-107737308 CCTGGCAACTGGCACCTGGTTGG + Intronic
1195917719 X:109952266-109952288 CCTAGCTGCTAGTGCCTGGCAGG - Intergenic
1201344389 Y:12966960-12966982 CCTAACACCTTGGACCTGGCTGG - Intergenic